Labshake search
Citations for Zymo Research :
51 - 100 of 782 citations for Urothelial Cell Culture Supplements since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Bioengineering 2020Quote: Cultures of SA(+) and SA(-) strains were grown to stationary phase and the genomic DNA was extracted (Zymo Research Quick-DNA Fungal/Bacterial Miniprep Kit ...
-
bioRxiv - Molecular Biology 2022Quote: ... then YAC/BAC DNA was isolated from overnight cultures using ZR BAC DNA Miniprep kit (Zymo Research D4048) and verified once again by next-generation sequencing ...
-
bioRxiv - Microbiology 2019Quote: Total RNA was isolated from 10 ml culture using either the Direct-zol™ RNA MiniPrep Kit (Zymo Research ...
-
bioRxiv - Microbiology 2020Quote: RNA was extracted from organoid-derived monolayer (ODM) and organoid cultures using Direct-zol RNA Microprep kit (Zymo) followed by on-column DNase I treatment following manufacturer’s protocol ...
-
bioRxiv - Cell Biology 2022Quote: ... Cultures were flash frozen and later total RNA was isolated using the Direct-zol kit (Zymo Research, R2050) with on-column DNase digestion and water elution ...
-
bioRxiv - Microbiology 2022Quote: ... RNA extractions were performed from 1 ml LB culture using the Direct-zol RNA MiniPrep Plus (Zymo Research, ZR2073). Total RNAs were reverse-transcribed into cDNAs using iScript™ cDNA Synthesis Kit (BioRad ...
-
bioRxiv - Cell Biology 2022Quote: ... PRP22 or SNU13 along with WT control and three independent cultures for young and old cell populations of strain harboring overexpression cassette of ARH1 and WT control were collected at the OD600 = 0.4 on -URA medium to isolate RNA from each culture using Quick-RNA 96 Kit from Zymo Research (Cat ...
-
bioRxiv - Molecular Biology 2021Quote: Three independent cultures for each strain were collected at the OD600=0.4 on YPD medium to isolate RNA from each culture using Quick-RNA 96 Kit from Zymo Research (Cat ...
-
bioRxiv - Microbiology 2021Quote: Total DNA was extracted from Salmonella overnight culture using Quick-DNA™ Miniprep Plus Kit (Zymo Research, Irvine, CA) following the manufacturer’s instructions ...
-
bioRxiv - Immunology 2022Quote: ... Successful clones were used to inoculate liquid culture for overnight growth followed by plasmid minipreps (Zyppy miniprep kit, Zymo). Pooled libraries were subjected to maxipreps (Nucleobond Maxiprep EF kit ...
-
bioRxiv - Neuroscience 2023Quote: ... Total RNA from the DRG and SGC cultures was extracted using the Direct-zol RNA Miniprep Kit (Zymo Research), and 0.5–1 μg RNAs were reverse transcribed using the iScript cDNA Synthesis Kit (Bio-Rad) ...
-
bioRxiv - Bioengineering 2024Quote: ... plasmid Homology Directed Repair Templates were produced by bacterial culture and standard plasmid preparation (Zymo Midiprep and Maxiprep kits) according to manufacturer instructions ...
-
bioRxiv - Evolutionary Biology 2021Quote: ... bacterial colonies were selected and grown in overnight cultures for plasmid purification using the Zyppy Plasmid Miniprep kit (Zymo Research). Sanger sequencing of clones was performed using M13F and M13R primers ...
-
bioRxiv - Molecular Biology 2019Quote: Yeast spheroplasts were prepared from a 50-ml culture grown to an OD600 of 0.8 by adding 350 U of zymolyase (Zymo Research) and incubating at 30°C for 25-30 min as previously described 22 ...
-
bioRxiv - Synthetic Biology 2019Quote: ... Then 1 mL of the culture was removed for DNA extraction using the Zymoprep yeast Plasmid Miniprep II (Zymo Research) kit ...
-
bioRxiv - Bioengineering 2021Quote: Colony PCR was performed on bacterial cultures and the PCR product purified using the DNA Clean and Concentrator kit (Zymo). Purified PCR products were sequenced at Genewiz (USA).
-
bioRxiv - Biochemistry 2021Quote: ... Isolated colonies were expanded into overnight cultures and the pDNA was isolated with the ZymoPURE Plasmid MiniPrep according to manufacturer’s protocol (Zymo Research). The mutation in the sequence was confirmed by sequencing (Macrogen).
-
bioRxiv - Bioengineering 2020Quote: ... Around 50 ml of yeast culture was harvested and DNA was extracted using Zymoprep Yeast Plasmid Miniprep II (Zymo Research). Two rounds of PCR were performed to amplify the coding sequence of the selected proteins and attach standard Illumina sequencing adaptors ...
-
bioRxiv - Microbiology 2022Quote: Total RNA was extracted from PCLS cultures using TRIzol reagent in combination with the RNA Clean & Concentrator Kit (Zymo Research). Briefly ...
-
bioRxiv - Microbiology 2023Quote: ... 4 ml of the cultures were used for total RNA extraction using the Direct-zol RNA extraction kit (Zymo Research) and TRI Reagent (Sigma-Aldrich ...
-
bioRxiv - Immunology 2023Quote: ScFv encoding plasmids were recovered from yeast cultures by miniprep with the Zymoprep yeast plasmid miniprep II kit (Zymo Research) as previously described(42) ...
-
bioRxiv - Cell Biology 2023Quote: ... and 100-mL maxiprep cultures of the plasmid-expressing bacteria were grown and purified by ZymoPure plasmid kits (Zymo Research). Each purification of the pTRIPZ-OGT-FH plasmid was resolved by 1% agarose gel to ensure no recombination occurred.
-
bioRxiv - Genomics 2023Quote: ... Plasmid is extracted from the bacterial culture using a 96-well mini-prep kit (Zymo kit, Zippy 96 plasmid kit). All clones are sequenced by Sanger sequencing at the site of the barcode using primer ACTTGTGTAGCGCCAAGTGC ...
-
bioRxiv - Biochemistry 2022Quote: ... These sorted libraries were grown for 1 day at 30°C shaking in SD-CAA media and then 300 µl of the cultures were miniprepped (Zymo Research) following the manufacturer’s protocol ...
-
bioRxiv - Microbiology 2020Quote: ... and from bacteria harvested from broth cultures were extracted with ZymoBIOMICS™ DNA Miniprep or Microprep kits (Zymo Research, Irvine, CA). Freshly-dissected ...
-
bioRxiv - Biochemistry 2022Quote: ... which were then grown in liquid culture overnight and purified using the ZymoPure endotoxin-free midiprep kit (Zymo Research, Irvine, CA). The Bxb1 recombinase expression vector (pCAG-NLS-HA Bxb1 ...
-
bioRxiv - Immunology 2021Quote: Overnight cultures of MACS sorted antibody-escaped and ACE2 preselected yeast populations were proceed to yeast plasmid extraction kit (Zymo Research). PCRs were performed to amplify the N26 barcode sequences as previously described13 ...
-
bioRxiv - Molecular Biology 2021Quote: Total RNA from three-week-old or four-week-old plant leaves was isolated from Arabidopsis plants and from in vitro potato cultures using a Direct-zol RNA MiniPrep Kit (Zymo Research). A TRIzol™ reagent (Invitrogen)-based protocol was used for the reverse transcription reaction performed with Superscript™ III Reverse Transcriptase (Invitrogen) ...
-
bioRxiv - Microbiology 2021Quote: ... and genomic DNA was extracted from 3 mL of overnight (TSB) broth culture using the ZR Duet DNA/RNA MiniPrep Plus kit (Zymo Research) following manufacturer’s protocol for the “suspended cells” option ...
-
bioRxiv - Immunology 2021Quote: scFv encoding plasmids were recovered from yeast cultures by yeast miniprep with the Zymoprep yeast plasmid miniprep II kit (Zymo Research). Isolated DNA was transformed into NEB5α strain of E ...
-
bioRxiv - Biochemistry 2022Quote: ... which were then grown in liquid culture overnight and purified using the ZymoPure endotoxin-free midiprep kit (Zymo Research, Irvine, CA). Transient expression of individual variants for western blots was carried out using a distinct set of expression vectors encoding the untagged CFTR variant cDNAs in the context of a pCDNA5 expression vector ...
-
bioRxiv - Microbiology 2022Quote: Genomic DNA was purified from all input and output library cultures using the Quick-DNA™ Miniprep Plus Kit (Zymo Research), following the manufacturer’s instructions ...
-
Simultaneous adjunctive treatment of malaria and its co-evolved genetic disorder sickle cell anaemiabioRxiv - Microbiology 2022Quote: Parasite genomic DNA and total RNA template were extracted from parasite culture using Quick-gDNA™ Blood MiniPrep (D3072, Zymo Research) and QIAamp RNA Blood Mini Kit (52304 ...
-
bioRxiv - Genetics 2023Quote: ... Equal volumes (at least 30 µL) of each culture were pooled and DNA was extracted using the YeaStarTM genomic DNA kit (ZYMO research).
-
bioRxiv - Microbiology 2022Quote: ... was performed by MicrobesNG (University of Birmingham) from pure culture material stabilised in DNA / RNA Shield buffer (Zymo Research, CA, USA). A further 150 genome sequences ...
-
bioRxiv - Neuroscience 2023Quote: RNA was extracted from neocortical regions of slice cultures using Trizol reagent followed by RNA Clean & Concentrator kit (Zymo research R1014). cDNA was synthesized with 0.5 μg of RNA using the cDNA Synthesis Kit (Bio-Rad 170-8891 ...
-
bioRxiv - Molecular Biology 2023Quote: RNA for RNA-seq was obtained by processing cerebellar tissue or CGN cultures with Trizol reagent followed by clean up on the Zymo Direct-zol RNA miniprep kit (Zymo #R2052). RNA purity was measured to ensure samples had A260/280 and A260/230 values > 1.9 ...
-
bioRxiv - Pharmacology and Toxicology 2023Quote: ... RNA was isolated from rat kidney samples and PTC cultures using Trizol + Direct-zol columns according to the referenced protocol (Zymo Research). For PTC cultures ...
-
bioRxiv - Genomics 2023Quote: Genomic DNA was extracted from 1.5 mL cultures of Bacteroides strains using the Zymobionics DNA Miniprep kit (Zymo Research, Irvine, CA) and used as input for IS-Seq as described previously (19) ...
-
bioRxiv - Microbiology 2023Quote: ... and PPL554 of bacterial cultures grown overnight in NB media overnight was extracted using the QuickDNA™ Fungal/Bacterial Miniprep Kit sourced from Zymo Research ...
-
bioRxiv - Evolutionary Biology 2024Quote: Antennae from twenty Rhodnius adult individuals were obtained from a laboratory culture (Orchard lab, University of Toronto Mississauga, Canada) and stored in DNA/RNA ShieldTM reagent (Zymo Research). Tissues were disrupted in Trizol using a Premium Multi-Gen 7XL Homogenizer (PRO Scientific ...
-
bioRxiv - Synthetic Biology 2021Quote: Plasmids were isolated from 5-10 mL yeast cultures either by alkaline lysis (39) or using Zymo Yeast Miniprep Kit I (Zymo Research D2001). Plasmids were then recovered into DH10B ElectroMax E ...
-
bioRxiv - Microbiology 2022Quote: ... Fungal DNA from the cultures was extracted using a ZymoBIOMICS® Quick-DNA Fungal/Bacterial Miniprep Kit (Zymo Research, Irvine, CA, USA) according to the manufacturer’s recommendations.
-
bioRxiv - Genomics 2020Quote: ... All plasmids used in this work were freshly prepared from 50 mL of Mach1 culture using ZymoPURE Plasmid Midiprep (Zymo Research Corporation) – a kit that involves an endotoxin removal procedure ...
-
bioRxiv - Microbiology 2023Quote: Bacterial genomic DNA was extracted from overnight cultures grown in 5 mL BHI broth using the Zymo BIOmics DNA Miniprep Kit (Zymo, Irvine, CA).
-
bioRxiv - Genomics 2023Quote: ... Single colonies were used to inoculate ampicillin liquid cultures grown overnight with shaking at 37°C and plasmids were subsequently purified with the ZR Plasmid Miniprep kit (Zymo Research #D4016). The purified plasmids were screened by Sanger sequencing (GeneWiz ...
-
bioRxiv - Microbiology 2023Quote: ... 0.5 mL of an overnight culture of EC1000 grown in LB media at 37°C was transferred to 50 mL of ZymoBroth (Zymo Research #M3015) and cultured for 15–16 hours at 22°C with shaking to obtain a culture of OD600=0.4 ...
-
bioRxiv - Cancer Biology 2021Quote: ... MDA-MB-231 in DRG co-culture and 2 biological replicates of MDA-MB-231 in DRG-conditioned media (1 replicate was excluded during analysis after clustering revealed it was an outlier) was extracted 24h after co-culture using RNA MiniPrep Kit (R1057, Zymo Research, Irvine, CA). Samples were confirmed to have RIN value >8.5 with Agilent Bioanalyzer before undergoing library preparation with TruSeq stranded mRNA kit by Tufts Genomics Core ...
-
Fusarium solani species complex genomes reveal bases of compartmentalisation and animal pathogenesisbioRxiv - Genomics 2022Quote: DNA isolation of FSSC mycelium cultures was carried out using ZYMO Quick-DNA Fungal/Bacterial Miniprep Kit (ZYMO Research, Irvine, USA, Cat. #D6005). The identity of these isolates was determined via multi-locus sequence typing (MLST ...
-
bioRxiv - Biochemistry 2021Quote: ... which were then grown in liquid culture prior to purification of the plasmid library using a ZymoPure II Endotoxin-Free Midiprep kit (Zymo Research, Irvine, CA). An analysis of our final DMS data suggest this library contains at least 7,614 of 7,686 possible variants ...