Labshake search
Citations for Zymo Research :
1 - 50 of 293 citations for Round Bottom Microplate 96 well since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Genomics 2023Quote: ... Each pool of heads or bodies was placed in a well of 96-well plates and total RNA was extracted using Quick-RNA 96 Kit by Zymo Research (Catalog no ...
-
bioRxiv - Bioengineering 2020Quote: ... The cultures were incubated in 96-well blocks (Zymo) at 30 °C with agitation for a total of 8 hours ...
-
bioRxiv - Cancer Biology 2021Quote: ... DNA is extracted from individual wells using Zyppy-96 Well Plasmid Miniprep Kit (Zymo Research #D4042) and sent for SANGER sequencing.
-
bioRxiv - Bioengineering 2022Quote: RNA extraction performed with a Quick-RNA 96 well kit (Zymo). cDNA generation performed with a high-capacity cDNA synthesis kit using random primers and RNase inhibitor (Thermo ...
-
bioRxiv - Genomics 2022Quote: ... separating 22 or 10 (control wells) single nuclei per well in a 96-well plate containing 2.5 μL of M-digestion buffer (Zymo, Cat. D5020-9), 0.25 μL of Proteinase K (Zymo ...
-
bioRxiv - Microbiology 2022Quote: ... and plasmid was isolated using 96-well yeast miniprep kits (Zymo D2005) according to manufacturer instructions ...
-
bioRxiv - Genomics 2021Quote: ... or single-nuclei (in 96-well PCR plates provided in the Zymo EZ-96 DNA Methylation-Direct™ Kit loaded with 4µL Proteinase K digestion buffer (1µL M-Digestion Buffer ...
-
bioRxiv - Microbiology 2024Quote: ... RNA was extracted with Direct-Zol 96 well plate kit (Zymo Research) and eluted into DNase/RNase-free water ...
-
bioRxiv - Microbiology 2020Quote: RNA was extracted from infected cells in the 96-well plate using a ZR-96 Viral RNA Kit (Zymo Research) per manufacturer instructions ...
-
bioRxiv - Genomics 2023Quote: ... Plasmid is extracted from the bacterial culture using a 96-well mini-prep kit (Zymo kit, Zippy 96 plasmid kit). All clones are sequenced by Sanger sequencing at the site of the barcode using primer ACTTGTGTAGCGCCAAGTGC ...
-
Parallelized engineering of mutational models using piggyBac transposon delivery of CRISPR librariesbioRxiv - Bioengineering 2020Quote: DNA extraction from clonal iPSC lines cultured in 96-well plates was performed using the Quick-DNA 96 Kit (Zymo Research). Briefly ...
-
bioRxiv - Systems Biology 2019Quote: ... RNA was isolated using the ZR-96-well Quick-RNA kit (Zymo Research) and quantified using either RiboGreen (Life Technologies ...
-
bioRxiv - Genetics 2020Quote: ... Lysates were purified using the ZR-96-well Quick-RNA kit (Zymo Research). RNA was quantified using RiboGreen (ThermoFisher Scientific ...
-
bioRxiv - Microbiology 2022Quote: ... and plasmid was isolated using a 96-well yeast miniprep kit (Zymo D2005) according to kit instructions ...
-
bioRxiv - Evolutionary Biology 2023Quote: ... and plasmid was isolated using a 96-well yeast miniprep kit (Zymo D2005) according to kit instructions ...
-
bioRxiv - Genomics 2024Quote: ... RNA was purified using the ZR-96-well Quick-RNA kit (Zymo Research). Gene expression was measured using qPCR with reagents from the Power SYBR Green RNA-to-Ct 1-step kit (Applied Biosystems) ...
-
bioRxiv - Genetics 2021Quote: ... All samples were randomized into 96-well plates for RNA extraction with the Direct-zol-96 RNA Kit (Zymo Research, Irvine, CA). Libraries constructed with the Lexogen QuantSeq 3′ mRNA-Seq Library Kit FWD (Lexogen ...
-
bioRxiv - Molecular Biology 2021Quote: ... Genomic DNA from individual eGFP+ cell lines was extracted from 96 well-plates using Quick-DNA Universal 96 Kit (Zymo Research, D4071) according to the manufacturer’s instructions ...
-
bioRxiv - Genomics 2019Quote: ... total RNA was extracted using the Quick-RNA 96 well format kit (Zymo Research) with in-column DNase treatment ...
-
bioRxiv - Developmental Biology 2020Quote: RNA was isolated directly from the TRIzol muscle samples using a 96 well plate extraction kit (Direct-zol™-96 RNA, Zymo Research, #R2054): after thawing to room temperature in 1,5 ml Eppendorf tubes ...
-
bioRxiv - Cancer Biology 2019Quote: ... 600 ng of purified DNA were randomly distributed on a 96-well plate and processed using the EZ-96 DNA Methylation kit (Zymo Research Corp., CA, USA) following the manufacturer’s recommendations for Infinium assays ...
-
bioRxiv - Microbiology 2020Quote: Viral RNA was isolated from viral supernatant with Zymo vRNA 96-well extraction kit (Zymo Research) according to manufacturer’s instructions ...
-
bioRxiv - Biochemistry 2021Quote: 96-well PCR plates with 50 µL of DH10B ‘Mix & Go Competent Cells’ (prepared using Zymo T3001) in each well were prepared beforehand so that high-throughput transfers could be done using multichannel pipettes or the Tecan Fluent ...
-
bioRxiv - Cell Biology 2023Quote: ... RNA was extracted from all samples in parallel using the Direct-ZOL 96 well plate format (Zymo, #R2054), and BRB-seq libraries were prepared as previously described 20 and further detailed by the MercuriusTM Protocol (Alithea Genomics) ...
-
bioRxiv - Genomics 2024Quote: ... Genomic DNA was extracted in the 96-well format using the Quick-DNA/RNA MagBead kit (Zymo Research R2130) according to the manufacturer’s instructions ...
-
A Data-Driven Transcriptional Taxonomy of Adipogenic Chemicals to Identify White and Brite AdipogensbioRxiv - Pharmacology and Toxicology 2021Quote: ... Total RNA was extracted and genomic DNA was removed using the 96-well Direct-zol MagBead RNA Kit (Zymo Research). RNA concentrations and contamination were determined spectrophotometrically using a Nanodrop ...
-
bioRxiv - Genomics 2023Quote: ... the supernatant was transferred to a deep 96-well plate and mixed with 400ul of genomic lysis buffer (Zymo, #D3004-1). The mix was stored at -20C to await further processing ...
-
bioRxiv - Genetics 2022Quote: ... followed by another round of clean up (Zymo RNA Clean and Concentrator 5). The final sequence of the spike-in mRNA is ...
-
bioRxiv - Cell Biology 2023Quote: ... followed by two rounds of DNA digestion using the DNA-free kit (Zymo). Samples were analyzed with a nanodrop 2000 and RNA Qubit to ensure sample concentrations were above 150 ng total for library construction ...
-
bioRxiv - Molecular Biology 2023Quote: ... Round 1 PCRs were cleaned using DNA Binding Buffer (Zymo ZD4004-1-L) and UPrep Micro Spin Columns (Genesee Scientific 88–343) ...
-
bioRxiv - Pharmacology and Toxicology 2020Quote: Total RNA was extracted and genomic DNA was removed using the Direct-zol 96-well MagBead RNA Kit (Zymo Research, Orange, CA). cDNA was synthesized from total RNA using the iScript™ Reverse Transcription System (Bio-Rad ...
-
bioRxiv - Genomics 2021Quote: ... Bisulfite conversion of 700 ng genomic DNA was performed using EZ-96 DNA Methylation Kit (Deep Well Format) (Zymo Research; Irvine, CA, USA) in accordance with the given kit instructions (www.zymoresearch.com) ...
-
bioRxiv - Immunology 2021Quote: ... Single viable CFSElow CD3+ CD8− CD4+ T cells were sorted into 96-well PCR plates containing DNA/RNA Shield (Zymo Research, Irvine, CA, USA) using FACSAria II and Diva Software (BD Biosciences ...
-
bioRxiv - Genomics 2020Quote: Bisulfite conversion of 1 ug genomic DNA was performed using the EZ-96 DNA Methylation Kit (Deep Well Format) (Zymo Research; Irvine, CA, USA) according to the manufacturer’s instructions (www.zymoresearch.com) ...
-
bioRxiv - Microbiology 2020Quote: ... The extracted DNA was then purified in the well-plate format using the ZR-96 Clean and Concentrator kit (Zymo research, Irvine, CA US), following manufacturer’s instructions and eluting in 6 µl of the supplied elution buffer ...
-
bioRxiv - Biochemistry 2020Quote: ... Products of the first-round PCR were pooled and purified by a DNA clean and concentrator kit (Zymo) and diluted to 2 ng/μL ...
-
bioRxiv - Molecular Biology 2019Quote: Plasmids from the final round of selection were isolated using the Zymoprep Yeast Plasmid Miniprep Kit (Zymo Research) and sequenced ...
-
bioRxiv - Genomics 2021Quote: ... The total RNA was purified for a second round with the Direct-zol RNA Miniprep Plus kit (Zymo Research) by following the manufacturer’s guidelines but in addition including 100 mM DTT in all wash buffers to prevent oxidation of S4U-labeled RNA.
-
bioRxiv - Molecular Biology 2023Quote: ... The CIP-treated RNA was subjected to another round of purification using the Direct-zol™ RNA MicroPrep (Zymo) kit ...
-
bioRxiv - Bioengineering 2023Quote: Plasmids of enriched nanobodies were isolated from the terminal round of sorting using a yeast miniprep kit (Zymo, D2004). For nanobody Fc fusions ...
-
bioRxiv - Microbiology 2021Quote: Zymo Quick-RNA Viral 96 Kit (Zymo Research) was used to isolate RNA from cell supernatants according to the manufacturer’s protocol ...
-
bioRxiv - Microbiology 2020Quote: ... Using a ZR-96 viral RNA kit (Zymo), RNA was extracted from the agar plugs and eluted in 40 µl nuclease free water (Invitrogen) ...
-
bioRxiv - Immunology 2020Quote: ... or ZR-96 Quick-RNA kit (Zymo Research), according to the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2021Quote: ... Using a ZR-96 viral RNA kit (Zymo), RNA was extracted from the agar plugs and eluted in 40 µl nuclease-free water (Invitrogen) ...
-
bioRxiv - Microbiology 2021Quote: ... Using a ZR-96 viral RNA kit (Zymo), RNA was extracted from the agar plugs and eluted in 40 μl nuclease-free water (Invitrogen) ...
-
bioRxiv - Microbiology 2023Quote: ... or Direct-zol-96 RNA Kit (Zymo Research). The samples were used for quantitating HuNoV RNA GEs by means of reverse transcription-quantitative PCR (RT-qPCR ...
-
bioRxiv - Microbiology 2022Quote: ... Using a ZR-96 viral RNA kit (Zymo), RNA was extracted from the agar plugs and eluted in 40 μl nuclease-free water (Invitrogen) ...
-
bioRxiv - Cancer Biology 2023Quote: ... The EZ-96 DNA Methylation Kit (Zymo Research) was used to perform the bisulphite conversion ...
-
bioRxiv - Molecular Biology 2021Quote: ... a further round of purification can be performed with the Zymo Oligo Clean and Concentrate spin-column kit (Zymo D4060). Labeled probe concentration was measured via NanoDrop OneC UV-Vis Spectrophotometer (Thermo Scientific 840-274200).
-
bioRxiv - Neuroscience 2021Quote: ... and wells were treated with tri-reagent (100 μL per well) (Zymo research corporation ...