Labshake search
Citations for Zymo Research :
451 - 500 of 6284 citations for Rat T Cell Surface Glycoprotein CD8 Beta Chain CD8B ELISA Kit since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2022Quote: ... gondii infected-PC12 cells that were harvested on day five post-infection using the Direct-zol RNA MiniPrep Plus kit (Zymo Research, USA) according to the manufacturer’s instructions ...
-
bioRxiv - Cancer Biology 2022Quote: Genomic DNA was extracted from HBEC controls and various HBEC derivative cells (three different clones for each group) using a Quick-DNA Miniprep Plus kit (Zymo Research, D4070). DNA samples were submitted to the Van Andel Institute’s Genomics Core (Controls ...
-
bioRxiv - Synthetic Biology 2022Quote: DNA bisulfite conversion was performed starting from a maximum of 1 × 105 pelleted cells per sample using the EZ DNA Methylation-Direct kit (Zymo Research #D5021), and following the manufacturer’s instructions ...
-
bioRxiv - Genetics 2023Quote: ... The amplicons were treated with DpnI restriction enzyme to remove the plasmid template and transformed into XL10 gold competent cells prepared by ‘Mix and Go!’ transformation kit (Zymo Research, T3001). The sequence of the isolated plasmids was confirmed using nanopore sequencing (Plasmidsaurus ...
-
bioRxiv - Cell Biology 2023Quote: ... genomic DNA was isolated from HL-7702 cell lines and 2 μg DNA was treated with sodium bisulfite using an EZ DNA Methylation-Gold Kit (ZYMO Research, USA) according to the manufacturer’s instructions ...
-
bioRxiv - Molecular Biology 2023Quote: ... between 400 million to 1.2 billion cells (two to six flash-frozen pellets) were lysed and extracted using the YeaStar Genomic DNA kit (Zymo 11-323), following the manufacturer’s instructions ...
-
bioRxiv - Genomics 2023Quote: RNA was extracted from GFP+/DAPI-FAC-sorted transient transfected HEK293T cells with ZR-Duet DNA/RNA MiniPrep Kit (Zymo Research, D7001). RNA-seq libraries were prepared using SMARTer Stranded total RNA-seq Kit v3 (Clontech ...
-
bioRxiv - Genomics 2023Quote: RNA was extracted from the flash-frozen cell pellets using the Zymo dual DNA/RNA extraction kit (D7001, Zymo, Irvine, CA, USA). Extractions were performed in batches of 12 where all treatments and timepoints per individual were extracted in the same batch ...
-
bioRxiv - Developmental Biology 2023Quote: ... 40 IVO blastocysts or 80 8-cell embryos were digested and bisulfite converted according to the manufacturer’s instruction of EZ DNA Methylation-Direct Kit (Zymo, Irvine, CA, USA). Bisulfite-specific primers were designed with the online Methyl Primer Express ...
-
bioRxiv - Genomics 2024Quote: ... RNA and DNA were simultaneously extracted from the cell samples using the Zymo Quick-DNA/RNA Microprep Plus Kit (Zymo Research, D7005) according to manufacturer’s instructions ...
-
bioRxiv - Molecular Biology 2024Quote: ... was used to purify genomic DNA from the cells followed by bisulfite conversion using 50 ng DNA along with the EZ DNA Methylation- Gold kit (Zymo Research D5005). 10 ng of bisulfite-converted DNA was used to generate the whole genome bisulfite sequencing (WGBS ...
-
bioRxiv - Cell Biology 2024Quote: Total RNA was extracted from snap-frozen cell pellets using the Quick-RNA Micro Prep Kit (Zymo Research, Irvine, CA, USA, R1050) and DNase digestion as per manufacturer’s instructions ...
-
bioRxiv - Cell Biology 2019Quote: RNA was isolated using a commercial kit (RNAmicro kit, Zymo Research), according to the manufacturer’s instructions ...
-
bioRxiv - Cell Biology 2020Quote: RNA was extracted and DNAseI-treated from DAC-treated AF2 cells using the ZR-Duet DNA/RNA MiniPrep (Plus) kit (Zymo Research Cat # D7003). This RNA was converted to cDNA using SuperScript III First-Strand Synthesis System (Invitrogen Cat# 18080051 ...
-
bioRxiv - Microbiology 2019Quote: ... Total RNA was extracted from the estradiol-grown strain DHT3 cells using the Direct-zol RNA MiniPrep Kit (Zymo Research; Tustin, CA, USA). The crude total RNA was further purified using Turbo DNA-free Kit (Thermo Fisher Scientific ...
-
bioRxiv - Developmental Biology 2020Quote: Total RNA was extracted from the sorted cells as described (Hrvatin et al., 2014a) and concentrated using the RNA Clean & Concentrator-5 kit (Zymo Research, Cat# R1013). Complementary DNA (cDNA ...
-
bioRxiv - Bioengineering 2022Quote: Yeast competent cells were transformed with polycistronic constructs containing fluorescent proteins using the Frozen-EZ yeast transformation II kit (Zymo Research, Irvine, CA) according to the manufacturer’s protocol ...
-
bioRxiv - Cancer Biology 2019Quote: RNA was isolated from normal bladder tissues and from VM-CUB1 and RT-112 cells using Direct-zol RNA MiniPrep kits (Zymo Research, Irvine, CA). Next ...
-
bioRxiv - Microbiology 2020Quote: ... supernatants were collected and viral RNA in the cell supernatants were extracted by using Direct-zol RNA MiniPrep kit (Zymo research, CA, USA) according to the manufacturer’s instructions ...
-
bioRxiv - Genetics 2020Quote: ... DNA was extracted from the resuspended pellet using the Zymo Quick-DNA Microprep Kit (cell suspensions protocol) per manufacturer’s instructions (Zymo Research, Irvine, CA, USA). The DNA was quantified using the dsDNA kit on a Qubit 2.0 (Thermo Fisher ...
-
bioRxiv - Bioengineering 2023Quote: ... and total genomic DNA was extracted from algal cell pellets (∼50-100 mg) with a Zymo Quick-DNA fungal/bacterial extraction kit (Zymo Research group, USA) according to the manufacturer’s protocol ...
-
bioRxiv - Cancer Biology 2023Quote: ... DNA purified from treated cells was first subjected to bisulphite conversion using the EZ-96 DNA Methylation-Direct MagPrep Kit (Zymo Research, U.S.; #D5044) to convert any unmodified cytosine residues to uracil ...
-
bioRxiv - Genomics 2023Quote: ... Plasmid is extracted from the bacterial culture using a 96-well mini-prep kit (Zymo kit, Zippy 96 plasmid kit). All clones are sequenced by Sanger sequencing at the site of the barcode using primer ACTTGTGTAGCGCCAAGTGC ...
-
bioRxiv - Genetics 2019Quote: ... and gel extraction kit (Zymoclean Gel DNA Recovery Kit) were from Zymo Research ...
-
bioRxiv - Bioengineering 2022Quote: ... using a commercial kit (ZymoPURE II Plasmid Maxiprep Kit; Zymo Research Corp). HEK293Ta cells (Genecopoeia ...
-
bioRxiv - Biophysics 2021Quote: ... Plasmids used for nucleofections were purified by Zymo midiprep kit (Zymo D4200) and concentrations were quantified by absorption at 260 nm ...
-
bioRxiv - Synthetic Biology 2023Quote: ... coli Transformation Kit (Zymo).
-
bioRxiv - Biophysics 2023Quote: ... Plasmids were purified by Zymo midiprep kit (Zymo D4200) and all cloning was confirmed by Sanger sequencing ...
-
bioRxiv - Microbiology 2023Quote: ... coli Transformation Kit (Zymo).
-
bioRxiv - Molecular Biology 2020Quote: ... the DNMT3A KO and WT HEK293 cells were cultured and RNA samples were extracted using Direct-zol RNA kit (Zymo Research; Irvine, CA, USA). Then cDNA was synthesized according to the protocol of the RT-PCR kit (Takara ...
-
bioRxiv - Plant Biology 2021Quote: ... total RNA was extracted from the isolated meiocytes (WT, clsy3, and clsy4) or tapetal cells using Direct-zol RNA Kit (Zymo Research, cat. no. R2061). Sequencing libraries were constructed using the RealSeq-Biofluids NGS Library Preparation Kit for miRNAs and small RNAs (BioCat ...
-
bioRxiv - Microbiology 2022Quote: ... Total DNA from the infected and uninfected control cells was isolated using a Quick-DNA miniprep kit according to the manufacturer-recommended protocol (Zymo Research, Irvine, CA, USA). To measure HIV-1 PVI ...
-
bioRxiv - Genetics 2022Quote: Genomic DNA was extracted from the iPSC colonies after single cell sorting and clonal expansion by using the Quick-DNA™ Miniprep Kit (Zymo Research 11-317A) following the manufacturer’s instructions ...
-
bioRxiv - Immunology 2020Quote: Total RNA was extracted from 1 × 105 cells using the Quick-RNA MiniPrep kit with Zymo-Spin IIICG columns (Zymo Research, Irvine, CA USA) as per manufacturer’s instructions ...
-
bioRxiv - Microbiology 2019Quote: ... total DNA or total RNA was extracted from 1−3 × 106 cells using the Quick-DNA or Quick-RNA Miniprep Kits (Zymo Research, Irvine, CA USA) respectively ...
-
bioRxiv - Pathology 2021Quote: Total RNA was obtained from choroidal EC cultures and frozen RPE cells using an RNA purification kit (Direct-zol RNA MiniPrep; Zymo Research, Irvine, CA, USA), as per the manufacturer’s protocol ...
-
bioRxiv - Neuroscience 2023Quote: DNA from each pool of 5-HT+ or 5-HT-cells was isolated and bisulfite-converted using the EZ DNA Methylation-Direct Kit (Zymo Research, Irvine, CA, USA) with the following adaptations ...
-
bioRxiv - Microbiology 2023Quote: ... we then tested the fidelity of this kit by extracting DNA from gypsum spiked with cells from a mock community (ZymoBIOMICS Microbial Community Standard, Zymo Research, Irvine, CA, USA). We added 25 μL of this standard (∼4.7×108 cells ...
-
bioRxiv - Molecular Biology 2022Quote: ... ZymoPure Plasmid Midiprep kit and RNA Clean & Concentrator kit were purchased from Zymo Research ...
-
bioRxiv - Microbiology 2023Quote: ... RNA was isolated using a commercial kit (DirectZol RNA Miniprep kit, Zymo Research) following manufacturer instructions ...
-
bioRxiv - Biochemistry 2023Quote: ... ZymoPURE II Midiprep Kit or the ZymoPURE II Maxiprep Kit (all Zymo Research).
-
bioRxiv - Immunology 2023Quote: ... the RNeasy Plus kit (specifically, the Quick RNA miniprep plus kit, Zymo, USA) was utilized and RNA was quantitated with Qubit RNA HS (High Sensitivity ...
-
bioRxiv - Biochemistry 2020Quote: ... Genomic DNA of bacterial samples as well as eukaryote cells was purified using the Quick-DNA™ Miniprep Plus Kit (Zymo Research, Irvine, California, US) using the recommendations of the manufacturer.
-
bioRxiv - Genomics 2022Quote: ... total RNA was extracted from peripheral white blood cells using the Zymo Research Direct-zol™ DNA/RNA Miniprep kit (Zymo Research Corporation, Irvine, CA), according to the manufacturer’s protocol ...
-
bioRxiv - Microbiology 2023Quote: ... A total of 500 ng of genomic DNA from cells in co-cultures were bisulfite-treated using the ZymoResearch EZ DNA Methylation kit (Zymo Research Corp, Irvine, CA, USA). The Infinium HD Methylation Assay (bisulfite modification ...
-
bioRxiv - Molecular Biology 2023Quote: ... DNA and RNA were extracted using commercial kits: Quick-DNA-fungal/bacterial MiniPrep™ kit (ZymoResearch) was used for DNA and Quick-RNA-fungal/bacterial MiniPrep™ kit (Zymo Research) was used for RNA ...
-
bioRxiv - Synthetic Biology 2022Quote: ... coli using GeneJet plasmid miniprep kit (ThermoScientific) or ZymoPURE plasmid midiprep kit (Zymo Research). Sequences of all plasmids were confirmed using Sanger sequencing performed by Eurofins Genomics ...
-
bioRxiv - Microbiology 2023Quote: ... coli using GeneJet plasmid miniprep kit (ThermoScientific) or ZymoPURE plasmid midiprep kit (Zymo Research). Sequences of all plasmids were confirmed using Sanger sequencing performed by Eurofins Genomics ...
-
bioRxiv - Microbiology 2024Quote: ... The three PCR fragments were purified (Zymo DNA Clean and Concentrator kit: ‘Zymo kit’) and used in a 1:1:1 molar ratio Golden Gate assembly reaction with BsaI (NEB ...
-
bioRxiv - Microbiology 2021Quote: ... coli transformation kit (Zymo Research) or standard electro-transformation protocols ...