Labshake search
Citations for Zymo Research :
101 - 150 of 6142 citations for Rat Nuclear Receptor Subfamily 4 Group A Member 2 NR4A2 ELISA Kit since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Molecular Biology 2023Quote: ... between 400 million to 1.2 billion cells (two to six flash-frozen pellets) were lysed and extracted using the YeaStar Genomic DNA kit (Zymo 11-323), following the manufacturer’s instructions ...
-
bioRxiv - Genetics 2021Quote: ... we dissected embryonic tails at E12.5 (n = 4) and E14.5 (n = 4) and extracted RNA using 50 µl Direct-zol (Zymo Research) following the manufacturer’s protocol and used the same library preparation procedures as for the parental samples ...
-
bioRxiv - Cancer Biology 2021Quote: ... genomic DNA and RNA were extracted from fresh frozen tumor (n=2) and normal (n=3) samples using the ZR-Duet DNA/RNA MiniPrep extraction kit (ZYMO RESEARCH, Irvine, CA). Quantification was performed with a NanoDrop One™ spectrophotometer (Thermo Fisher Scientific ...
-
bioRxiv - Synthetic Biology 2023Quote: ... genomic DNA was extracted from 2-10 mL of stationary cultures with the Zymo Research Midiprep gDNA kit (Zymo Research EUROPE GmbH, Germany). Library preparation and sequencing were performed at Novogene (UK ...
-
bioRxiv - Genomics 2023Quote: ... Purification was performed according to manufacturer’s instructions and the converted DNA was then eluted in 32.5 µl nuclease-free water (17 µl × 2 times) through a column from the DNA Clean & Concentrator kit (Zymo Research, cat. no. D4003).
-
bioRxiv - Cancer Biology 2022Quote: ... The outer PCR products amplified using primer #1 and #2 were purified and concentrated using the DNA Clean and Concentrator 5 kit (Zymo Research, Orange, CA) and eluted in 20ul of TE buffer ...
-
bioRxiv - Physiology 2023Quote: ... Complementary DNA (cDNA) was synthesized from 1 to 2 μg of RNA using High-Capacity RNA-to-cDNA™ Kit (Zymo Research, Irvine, CA). Quantitative real-time polymerase chain reaction (qPCR ...
-
bioRxiv - Cell Biology 2024Quote: ... Samples were then treated with Turbo DNAse 2 to 3 times and then purified with the RNA Clean and Concentrator-5 Kit (Zymo Research Cat#: 11-325) according to the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2019Quote: ... 2 U/mL Zymolyase (Zymo research), 22 U/mL lysostaphin (MERCK) ...
-
bioRxiv - Microbiology 2021Quote: ... 2 U/mL Zymolyase (Zymo research), 22 U/mL lysostaphin (MERCK) ...
-
bioRxiv - Pharmacology and Toxicology 2020Quote: RNA was isolated from the cell culture supernatant of SARS-CoV-2-infected cells using the Quick-RNA Viral Kit (Zymo, California, USA cat no. R1035) according to the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2022Quote: ... 2 U/mL Zymolyase (Zymo Research Corporation), 22 U/mL lysostaphin (Sigma-Aldrich) ...
-
bioRxiv - Pharmacology and Toxicology 2023Quote: ... RNA was isolated from rat kidney samples and PTC cultures using Trizol + Direct-zol columns according to the referenced protocol (Zymo Research). For PTC cultures ...
-
bioRxiv - Molecular Biology 2023Quote: ... and 2 volumes of RNA binding buffer (ZYMO) was added to each volume of RNA sample ...
-
bioRxiv - Microbiology 2020Quote: ... Most of the supernatant was removed and 750 μl of ZymoBIOMICS Lysis Solution and 19 μl of proteinase K (D3001-2-20/D3001-2-5, Zymo Research) were added to the remaining 200 μl of the samples and incubated for 30 min at +55 °C ...
-
bioRxiv - Synthetic Biology 2022Quote: ... The resulting product was purified using 4 spin columns (Zymo, DCC-25) to produce the round 1 product.
-
bioRxiv - Microbiology 2019Quote: ... 2 times volume of Viral RNA Buffer from Zymo Research (R1034-1-100 ...
-
bioRxiv - Genomics 2022Quote: ... 0.25 μL of Proteinase K (Zymo, D3001-2-5), and 2.5μL of H2O ...
-
bioRxiv - Microbiology 2023Quote: ... 2 U/mL Zymolyase (Zymo Research Corporation, CA, USA), 22 U/mL lysostaphin (Sigma-Aldrich) ...
-
bioRxiv - Microbiology 2023Quote: ... pellet resuspended with 2 ml Host Depletion Solution (Zymo) and transferred without the beads to two 1.5 ml tubes per sample ...
-
bioRxiv - Genomics 2023Quote: ... Libraries were eluted in DNA Elution Buffer (Zymo Research, Cat #D3004-4-10). The concentration and average size of the libraries was verified using the TapeStation DNA 5000 Assay Reagents and Screen Tapes (Agilent ...
-
bioRxiv - Genomics 2023Quote: ... The DNA pellet was eluted in elution buffer (D3004-4-10 Zymo Research) and incubated at 50°C for 10 minutes ...
-
bioRxiv - Microbiology 2022Quote: ... Gel extraction kit and DNA purification kit were from Zymo Research ...
-
bioRxiv - Neuroscience 2020Quote: ... 1 ml Proteinase K (20 mg, Zymo D3001-2-20), 9 mL water ...
-
bioRxiv - Microbiology 2023Quote: ... 2 mock community samples (Zymo Research DNA standard I D6305), 2 negative DNA extraction samples ...
-
bioRxiv - Microbiology 2023Quote: ... 2 mock community samples (Zymo Research DNA standard I D6305), 2 negative DNA extraction samples ...
-
bioRxiv - Cell Biology 2019Quote: RNA was isolated using a commercial kit (RNAmicro kit, Zymo Research), according to the manufacturer’s instructions ...
-
bioRxiv - Genomics 2023Quote: ... Plasmid is extracted from the bacterial culture using a 96-well mini-prep kit (Zymo kit, Zippy 96 plasmid kit). All clones are sequenced by Sanger sequencing at the site of the barcode using primer ACTTGTGTAGCGCCAAGTGC ...
-
bioRxiv - Synthetic Biology 2022Quote: ... 10 µL of Mag-Binding beads (Zymo Research, #D4100-2-24) was added and the sample was incubated for 3 min at room temperature ...
-
bioRxiv - Genetics 2019Quote: ... and gel extraction kit (Zymoclean Gel DNA Recovery Kit) were from Zymo Research ...
-
bioRxiv - Bioengineering 2022Quote: ... using a commercial kit (ZymoPURE II Plasmid Maxiprep Kit; Zymo Research Corp). HEK293Ta cells (Genecopoeia ...
-
bioRxiv - Biophysics 2021Quote: ... Plasmids used for nucleofections were purified by Zymo midiprep kit (Zymo D4200) and concentrations were quantified by absorption at 260 nm ...
-
bioRxiv - Synthetic Biology 2023Quote: ... coli Transformation Kit (Zymo).
-
bioRxiv - Biophysics 2023Quote: ... Plasmids were purified by Zymo midiprep kit (Zymo D4200) and all cloning was confirmed by Sanger sequencing ...
-
bioRxiv - Microbiology 2023Quote: ... coli Transformation Kit (Zymo).
-
bioRxiv - Genomics 2021Quote: ... Pellets were then resuspended in Zymo DNA elution buffer (Zymo, Cat No: D3004-4-10), and placed on the heat block at 65°C for 1 hour to completely dissolve the genomic DNA.
-
bioRxiv - Genetics 2023Quote: ... Microinjections were performed with 4-5 µg/µl (diluted in nuclease free water, Zymo Research) fas5 and GFP dsRNA on a Femtojet microinjector (Eppendorf ...
-
bioRxiv - Molecular Biology 2022Quote: ... ZymoPure Plasmid Midiprep kit and RNA Clean & Concentrator kit were purchased from Zymo Research ...
-
bioRxiv - Microbiology 2023Quote: ... RNA was isolated using a commercial kit (DirectZol RNA Miniprep kit, Zymo Research) following manufacturer instructions ...
-
bioRxiv - Biochemistry 2023Quote: ... ZymoPURE II Midiprep Kit or the ZymoPURE II Maxiprep Kit (all Zymo Research).
-
bioRxiv - Immunology 2023Quote: ... the RNeasy Plus kit (specifically, the Quick RNA miniprep plus kit, Zymo, USA) was utilized and RNA was quantitated with Qubit RNA HS (High Sensitivity ...
-
bioRxiv - Developmental Biology 2021Quote: ... 3 and 4 by lysing cells in the 6-well plate in RNA lysis buffer (Zymo) and freezing at −80 °C until extraction ...
-
bioRxiv - Molecular Biology 2023Quote: ... DNA and RNA were extracted using commercial kits: Quick-DNA-fungal/bacterial MiniPrep™ kit (ZymoResearch) was used for DNA and Quick-RNA-fungal/bacterial MiniPrep™ kit (Zymo Research) was used for RNA ...
-
bioRxiv - Synthetic Biology 2022Quote: ... coli using GeneJet plasmid miniprep kit (ThermoScientific) or ZymoPURE plasmid midiprep kit (Zymo Research). Sequences of all plasmids were confirmed using Sanger sequencing performed by Eurofins Genomics ...
-
bioRxiv - Microbiology 2023Quote: ... coli using GeneJet plasmid miniprep kit (ThermoScientific) or ZymoPURE plasmid midiprep kit (Zymo Research). Sequences of all plasmids were confirmed using Sanger sequencing performed by Eurofins Genomics ...
-
bioRxiv - Microbiology 2024Quote: ... The three PCR fragments were purified (Zymo DNA Clean and Concentrator kit: ‘Zymo kit’) and used in a 1:1:1 molar ratio Golden Gate assembly reaction with BsaI (NEB ...
-
bioRxiv - Microbiology 2021Quote: ... coli transformation kit (Zymo Research) or standard electro-transformation protocols ...
-
bioRxiv - Neuroscience 2020Quote: ... or MiniPrep Kit (R2052, Zymo Research ...
-
bioRxiv - Synthetic Biology 2020Quote: ... coli Transformation Kit (Zymo Research).
-
bioRxiv - Synthetic Biology 2021Quote: ... coli Transformation Kit from Zymo Research (Irvine ...