Labshake search
Citations for Zymo Research :
51 - 100 of 6064 citations for Rat High Mobility Group Protein B1 HMGB1 ELISA Kit since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Molecular Biology 2020Quote: ... RNA from rat lungs was isolated from the lysate using Direct-zol RNA MiniPrep (Zymo Research), according to the manufacturer’s protocol ...
-
bioRxiv - Bioengineering 2022Quote: Yeast competent cells were transformed with polycistronic constructs containing fluorescent proteins using the Frozen-EZ yeast transformation II kit (Zymo Research, Irvine, CA) according to the manufacturer’s protocol ...
-
bioRxiv - Biochemistry 2020Quote: ... then loaded directly onto a Ni-NTA protein miniprep column (His Spin Protein Miniprep, Zymo Research). Protein was washed following the manufacturer’s instructions ...
-
bioRxiv - Immunology 2024Quote: High-quality RNA was extracted from colon samples using Tri-Reagent (Zymo Research) and Direct-zol™ RNA MiniPrep w/ Zymo-Spin™ IIC Columns (Zymo Research ...
-
bioRxiv - Microbiology 2021Quote: ... we extracted High-Molecular Weight (HMW) DNA through Quick-DNA HMW MagBead (Zymo Research) and non-HMW DNA through DNA Miniprep Kit (Zymo Research) ...
-
bioRxiv - Pharmacology and Toxicology 2023Quote: ... RNA was isolated from rat kidney samples and PTC cultures using Trizol + Direct-zol columns according to the referenced protocol (Zymo Research). For PTC cultures ...
-
bioRxiv - Neuroscience 2020Quote: ... Protein degradation was performed by adding Proteinase K (Zymo) and Qiagen Protease (Qiagen) ...
-
bioRxiv - Cell Biology 2023Quote: ... ChIP-DNA was prepared using ZymoMag Protein A beads (Zymo Research). Input samples were also prepared using 10% of chromatin samples ...
-
bioRxiv - Microbiology 2022Quote: ... Gel extraction kit and DNA purification kit were from Zymo Research ...
-
bioRxiv - Microbiology 2019Quote: ... The filter-associated biofilm was disrupted by adding 1 ml PBS + 0.01% Triton X-100 detergent and agitating the tubes at high speed for 2 minutes using a Genie Disruptor (Zymo). This suspension was diluted ...
-
bioRxiv - Genomics 2020Quote: ... 7) We verified the presence of high molecular weight DNA products in the samples before purifying nucleic acids by Zymo DNA Clean & Concentrator-5 (ZYMO Research).
-
bioRxiv - Microbiology 2022Quote: ... Filters were then transferred into a 1.5 ml tube and the filter-associated cells were resuspended by adding 1 ml 1X PBS + 0.05% Triton X-100 detergent and agitating the tubes at high speed for 2 minutes using a Genie Disruptor (Zymo). This suspension as well as the inoculum were diluted ...
-
bioRxiv - Cell Biology 2019Quote: RNA was isolated using a commercial kit (RNAmicro kit, Zymo Research), according to the manufacturer’s instructions ...
-
bioRxiv - Genomics 2023Quote: ... Plasmid is extracted from the bacterial culture using a 96-well mini-prep kit (Zymo kit, Zippy 96 plasmid kit). All clones are sequenced by Sanger sequencing at the site of the barcode using primer ACTTGTGTAGCGCCAAGTGC ...
-
bioRxiv - Microbiology 2022Quote: ... The high molecular weight bands were excised with a razor and dissolved in 3 volumes of Zymo Agarose Dissolving Buffer (Zymo D4001) at 50°C ...
-
bioRxiv - Genetics 2019Quote: ... and gel extraction kit (Zymoclean Gel DNA Recovery Kit) were from Zymo Research ...
-
bioRxiv - Bioengineering 2022Quote: ... using a commercial kit (ZymoPURE II Plasmid Maxiprep Kit; Zymo Research Corp). HEK293Ta cells (Genecopoeia ...
-
bioRxiv - Biophysics 2021Quote: ... Plasmids used for nucleofections were purified by Zymo midiprep kit (Zymo D4200) and concentrations were quantified by absorption at 260 nm ...
-
bioRxiv - Synthetic Biology 2023Quote: ... coli Transformation Kit (Zymo).
-
bioRxiv - Biophysics 2023Quote: ... Plasmids were purified by Zymo midiprep kit (Zymo D4200) and all cloning was confirmed by Sanger sequencing ...
-
bioRxiv - Microbiology 2023Quote: ... coli Transformation Kit (Zymo).
-
bioRxiv - Molecular Biology 2022Quote: ... ZymoPure Plasmid Midiprep kit and RNA Clean & Concentrator kit were purchased from Zymo Research ...
-
bioRxiv - Microbiology 2023Quote: ... RNA was isolated using a commercial kit (DirectZol RNA Miniprep kit, Zymo Research) following manufacturer instructions ...
-
bioRxiv - Biochemistry 2023Quote: ... ZymoPURE II Midiprep Kit or the ZymoPURE II Maxiprep Kit (all Zymo Research).
-
bioRxiv - Immunology 2023Quote: ... the RNeasy Plus kit (specifically, the Quick RNA miniprep plus kit, Zymo, USA) was utilized and RNA was quantitated with Qubit RNA HS (High Sensitivity ...
-
bioRxiv - Developmental Biology 2023Quote: Total RNA was extracted from 10 trunk fragments per biological replicate using the standard Trizol RNA extraction protocol with high salt precipitation and clean-up on Zymo RNA columns (Zymo R1013/R1017). RNA (1 μg ...
-
bioRxiv - Molecular Biology 2023Quote: ... DNA and RNA were extracted using commercial kits: Quick-DNA-fungal/bacterial MiniPrep™ kit (ZymoResearch) was used for DNA and Quick-RNA-fungal/bacterial MiniPrep™ kit (Zymo Research) was used for RNA ...
-
bioRxiv - Synthetic Biology 2022Quote: ... coli using GeneJet plasmid miniprep kit (ThermoScientific) or ZymoPURE plasmid midiprep kit (Zymo Research). Sequences of all plasmids were confirmed using Sanger sequencing performed by Eurofins Genomics ...
-
bioRxiv - Microbiology 2023Quote: ... coli using GeneJet plasmid miniprep kit (ThermoScientific) or ZymoPURE plasmid midiprep kit (Zymo Research). Sequences of all plasmids were confirmed using Sanger sequencing performed by Eurofins Genomics ...
-
bioRxiv - Microbiology 2024Quote: ... The three PCR fragments were purified (Zymo DNA Clean and Concentrator kit: ‘Zymo kit’) and used in a 1:1:1 molar ratio Golden Gate assembly reaction with BsaI (NEB ...
-
bioRxiv - Biochemistry 2021Quote: ... Cleared supernatant was discarded and the concentrated high-speed pellet (“100,000 x g pellet”) was lysed directly in 300 μl of TRI reagent (Zymo Research, R2050-1-200). RNA extraction was performed according to instructions for the Direct-zol RNA Miniprep Kit (Zymo Research ...
-
bioRxiv - Bioengineering 2024Quote: ... Primers were custom designed by Zymo Research to ensure best coverage of the 16S gene and high sensitivity - Quick-16S™ Primer Set V1-V3 (Zymo Research, Irvine, CA). The final PCR products were quantified with qPCR fluorescence readings and pooled together based on equal molarity ...
-
bioRxiv - Microbiology 2021Quote: ... coli transformation kit (Zymo Research) or standard electro-transformation protocols ...
-
bioRxiv - Neuroscience 2020Quote: ... or MiniPrep Kit (R2052, Zymo Research ...
-
bioRxiv - Synthetic Biology 2020Quote: ... coli Transformation Kit (Zymo Research).
-
bioRxiv - Synthetic Biology 2021Quote: ... coli Transformation Kit from Zymo Research (Irvine ...
-
bioRxiv - Genomics 2021Quote: ... the RCC kit (Zymo Research).
-
bioRxiv - Developmental Biology 2020Quote: ... or Quick-RNA kit (Zymo). Reverse transcription was carried out by using the High-Capacity RNA-to-cDNA Kit (ThermoFisher) ...
-
bioRxiv - Developmental Biology 2023Quote: ... and RNA purification kit (Zymo). cDNA was generated using Maxima First Strand cDNA synthesis kit (Thermo Fisher Scientific) ...
-
bioRxiv - Synthetic Biology 2023Quote: ... coli Transformation Kit (Zymo Research). For each transformation ...
-
bioRxiv - Synthetic Biology 2024Quote: ... coli Transformation Kit (Zymo Research), and transformations were carried out using 50 ng of ligation product or plasmid ...
-
bioRxiv - Genetics 2023Quote: ... ZymoPure Midiprep Kit (Zymo Research) was used to prepare donor constructs for embryo injection ...
-
bioRxiv - Microbiology 2024Quote: ... Correct amplicons were isolated by Zymo PCR purification kit (Zymo Research). The PCR products were cloned into a PCR linearized pEcgRNA-guide plasmid to make the pEcgRNA-guide-RT plasmid using In-fusion® HD-cloning kit (Takara Bio ...
-
bioRxiv - Cancer Biology 2024Quote: ... coli Transformation Kit (Zymo Research). Plasmids were prepared following standard protocols ...
-
bioRxiv - Biochemistry 2021Quote: ... Zyppy™ Plasmid Miniprep kit and DNA Clean & Concentrator™ kit were purchased from Zymo Research ...
-
bioRxiv - Developmental Biology 2020Quote: ... Total RNA was isolated from using DNA/RNA Duet Kit miniprep kit (Zymo Research, USA).
-
bioRxiv - Genetics 2022Quote: ... cerevisiae temperature-sensitive strain TSA64 en masse using EZ Kit Yeast Transformation kit (Zymo Research). The entire transformed library was grown in selective media (YPD + clonNAT ...
-
bioRxiv - Genetics 2024Quote: ... cerevisiae double mutant strain sml1Δ rad53Δ using the EZ Kit Yeast Transformation kit (Zymo Research) to obtain ∼1,000,000 clones per region ...
-
bioRxiv - Synthetic Biology 2022Quote: ... whereas Zymoclean Gel DNA Recovery Kit and Zymoprep Yeast Plasmid Miniprep Kits were purchased from Zymo Research (Irvine ...
-
bioRxiv - Microbiology 2019Quote: ... DNA was extracted using a ‘Quick-DNA™’ Fungal/Bacterial 96 kit extraction kit (Zymo Research). A Nextera DNA library preparation kit (Illumina ...