Labshake search
Citations for Zymo Research :
251 - 300 of 473 citations for Rat ERICH6 shRNA Plasmid since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Immunology 2021Quote: ... cultures using a ZymoPURE II Plasmid Maxiprep (Zymo, cat. no. D4203). 25 μg plasmid was used to transfect 25 ml Expi293F (Thermo ...
-
bioRxiv - Microbiology 2022Quote: ... coli using the Zymoprep Yeast Plasmid Miniprep II kit (Zymo Research).
-
bioRxiv - Systems Biology 2023Quote: ... The library was purified with ZymoPURE II Plasmid Maxiprep Kit (Zymo). The representation of individual sequences in the library was verified by sequencing the resulting library on MiSeq instrument (lllumina).
-
bioRxiv - Synthetic Biology 2024Quote: The Zyppy-96 Plasmid MagBead Miniprep Kit was purchased from Zymo Research (Irving ...
-
bioRxiv - Neuroscience 2023Quote: ... All plasmid DNA were purified using the ZymoPure II (Zymo Research) plasmid preparation kit and were resuspended in molecular biology grade water.
-
bioRxiv - Genetics 2024Quote: ... and then harvested for glycerol stock and plasmid preparations (Zymo Research). Positive clones were identified by restriction digestion (NheI-HF and XhoI ...
-
bioRxiv - Bioengineering 2019Quote: ... All plasmids were grown in JM109 chemically competent cells (Zymo Research #T3005) and isolated using ZyppyTM Plasmid Miniprep (Zymo Research #D4037 ...
-
bioRxiv - Bioengineering 2021Quote: ... and DNA was isolated using the Zyppy plasmid miniprep kit (Zymo Research). DNA was sent for Sanger sequencing (Genewiz ...
-
bioRxiv - Genomics 2021Quote: ... DNA was isolated using the ZymoPURE II Plasmid Maxiprep Kit (Zymo Research). Plasmid DNA from multiple rounds of assembly and electroporation were combined according to the measured electroporation efficiency to achieve 25-fold coverage of the library ...
-
bioRxiv - Microbiology 2022Quote: ... and plasmid was isolated using 96-well yeast miniprep kits (Zymo D2005) according to manufacturer instructions ...
-
bioRxiv - Microbiology 2022Quote: Plasmids encoding the wildtype and ompK36 mutants were isolated using miniprep (Zymo) and amplified by PCR using a forward primer containing the T7 promoter sequence (TAATACGACTCACTATAGGAAAAGGCATATAACAAACAGAGGG ...
-
bioRxiv - Genetics 2022Quote: ... coli bacterial overnight culture using the Zyppy plasmid miniprep kit (Zymo Research), or 200 mL of culture was processed with the PureLink HiPure pasmid midiprep kit (Invitrogen ...
-
bioRxiv - Molecular Biology 2019Quote: ... Plasmids were isolated using miniprep or midiprep kits (Qiagen or Zymo, respectively).
-
bioRxiv - Systems Biology 2021Quote: ... Library Maxipreps were performed using the ZymoPURE II Plasmid Maxiprep Kit (Zymo).
-
bioRxiv - Cell Biology 2021Quote: ... and DNA isolation via MAXI-prep ZymoPURE II Plasmid kits (Zymo Research).
-
bioRxiv - Immunology 2021Quote: ... DNA plasmids were purified from DH5alpha Competent Cell (Zymo, cat. no. T3007) cultures using a ZymoPURE II Plasmid Maxiprep (Zymo ...
-
bioRxiv - Bioengineering 2022Quote: ... using a commercial kit (ZymoPURE II Plasmid Maxiprep Kit; Zymo Research Corp). HEK293Ta cells (Genecopoeia ...
-
bioRxiv - Physiology 2022Quote: ... Endotoxin was eliminated by treating the plasmid with Endozero columns (Zymo Research).
-
bioRxiv - Developmental Biology 2023Quote: ... The plasmid library was purified using a column purification kit (Zymo, D4202). We first assessed the integrity of the TrackerSeq barcode libraries by sequencing the library to a depth of approximately 42 million reads to test whether any barcode was over-represented ...
-
bioRxiv - Microbiology 2023Quote: ... low yield integrating plasmids were midi or maxiprepped (Zymo Research #4200 / #4202) using the low copy number protocols ...
-
bioRxiv - Cell Biology 2023Quote: ... endotoxin was eliminated by treating the plasmids with Endozero columns (Zymo Research) before proceeding to AAV production ...
-
bioRxiv - Biochemistry 2022Quote: ... Vector DNA was purified using the Zyppy Plasmid Miniprep Kit (Zymo Research) according to the manufacturer’s protocol ...
-
bioRxiv - Neuroscience 2023Quote: ... The DNA was purified using ZymoPURE Plasmid Maxiprep Kit (D4203, Zymo Research).
-
bioRxiv - Synthetic Biology 2023Quote: ... the shuttle plasmid was purified using column purification (Zymo Research CN# D4013) according to manufacturer protocols.
-
bioRxiv - Biochemistry 2024Quote: ... Plasmids were purified using a ZymoPURE Midiprep Kit (Zymo Research, Irvine, CA). DMS experiments were carried out using a previously described pcDNA5 FRT vector containing mGnRHR cDNA bearing an N-terminal influenza hemagglutinin (HA ...
-
bioRxiv - Microbiology 2023Quote: ... Verified vectors were miniprepped using the ZR Plasmid miniprep – Classic kit (Zymo) and transformed into chemically-competent WM6026 cells in 96-well format ...
-
bioRxiv - Microbiology 2020Quote: pUltra-RFP was purified using ZymoPure II Plasmid Midi Prep kit (Zymo Research), digested with BamHI and EcoRI ...
-
bioRxiv - Evolutionary Biology 2021Quote: ... coli cultures using ZR Plasmid MiniPrep Purification Kit (Zymo Research, Cat. No. D4015) for sequence verification ...
-
bioRxiv - Microbiology 2019Quote: ... The digested plasmid DNA samples were purified with DNA Clean & Concentrator™(Zymo) kit according to the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2019Quote: ... The digested plasmid DNA samples were purified with DNA Clean & Concentrator™(Zymo) kit according to the manufacturer’s instructions.
-
bioRxiv - Biophysics 2020Quote: ... The plasmid was harvested using the Zymo Miniprep Kit (Zymo Research, Irivine, CA). To confirm that no mutations were introduced ...
-
bioRxiv - Developmental Biology 2022Quote: Linearized plasmid DNA was cleaned using DNA Clean & concentrator-5 (Zymo Research #D4014). In situ hybridization was completed according to a standard protocol (Cunningham and Monk ...
-
bioRxiv - Biochemistry 2022Quote: ... and plasmid was purified using a Zymo-Spin IIN spin column (Zymo Research). Purified samples were then amplified using primers bracketing the cut-site sequence ...
-
bioRxiv - Synthetic Biology 2022Quote: ... Each tube was processed with the ZymoPURE II Plasmid Midiprep Kit (Zymo Research). The resulting midipreps were pooled and a dilution of 10 ng/μL was prepared ...
-
bioRxiv - Synthetic Biology 2019Quote: ... The resulting plasmids were purified with DNA Clean & Concentrator-5™ (Zymo Research), eluted with nuclease-free water ...
-
bioRxiv - Cancer Biology 2019Quote: ... plasmid DNA was recovered from yeast using a Zymoprep kit (Zymo Research Corp), transformed into DH10b electrocompetent E ...
-
bioRxiv - Biochemistry 2020Quote: ... Plasmid DNA was transformed into DH5α cells and purified by miniprep (Zymo Research). DNA was ethanol/sodium acetate precipitated for purification and concentration ...
-
bioRxiv - Genomics 2021Quote: ... Finally we performed maxipreps using the ZymoPure Plasmid Maxiprep kit (Zymo, Cat # D4202).
-
bioRxiv - Microbiology 2022Quote: ... and plasmid was isolated using a 96-well yeast miniprep kit (Zymo D2005) according to kit instructions ...
-
bioRxiv - Molecular Biology 2022Quote: ... ZymoPure Plasmid Midiprep kit and RNA Clean & Concentrator kit were purchased from Zymo Research ...
-
bioRxiv - Evolutionary Biology 2023Quote: ... Gibson’s reaction-derived plasmid product was used to transform JM109 cells (Zymo Research), and colonies were individually grown overnight for minipreps with Zyppy Plasmid Miniprep Kit (Zymo Research) ...
-
bioRxiv - Biophysics 2023Quote: ... Plasmids were purified using a commercial miniprep kit (D4013, Zymo Research; Irvine, CA). PCR products were purified using a commercial DNA purification kit (D4054 ...
-
bioRxiv - Microbiology 2023Quote: ... PCR products were purified using the ZR Plasmid Miniprep-Classic Kit (Zymo Research), followed by Sanger sequencing using either primer 2235 or 2236.
-
bioRxiv - Synthetic Biology 2024Quote: ... using the Zyppy-96 Plasmid MagBead Miniprep Kit (Zymo Research, Irving CA, USA), according to manufacturer’s instructions with the modification of pipet mixing during the lysis and neutralization steps and an extended elution time of 10 minutes ...
-
bioRxiv - Evolutionary Biology 2023Quote: ... and plasmid was isolated using a 96-well yeast miniprep kit (Zymo D2005) according to kit instructions ...
-
bioRxiv - Genetics 2023Quote: ... Plasmids were then transformed into Zymo Mix & Go DH5α Competent Cells (Zymo T3007) for verification and amplification before re-purification and transformation into MG1655 E ...
-
bioRxiv - Pharmacology and Toxicology 2023Quote: ... RNA was isolated from rat kidney samples and PTC cultures using Trizol + Direct-zol columns according to the referenced protocol (Zymo Research). For PTC cultures ...
-
bioRxiv - Cell Biology 2023Quote: Genomic DNA was extracted from 200-250µm-thick cryopreserved rat lung tissue using the Zymo Quick-DNA MicroPrep Kit (Zymo, Irvine, CA), according to the manufacturer’s instructions ...
-
bioRxiv - Genetics 2019Quote: Plasmid DNA from each sample was isolated via lysis and mini prep (Zymo Research). Three PCR steps were performed to amplify the DNA for sequencing using Phusion polymerase (NEB) ...
-
bioRxiv - Microbiology 2021Quote: ... gDNA (which contains exogeneous plasmids) was extracted using the Quick-DNA miniprep kit (Zymo). Sanger sequencing was used to identify the library insert associated with each clonal line ...