Labshake search
Citations for Zymo Research :
101 - 150 of 6099 citations for Rat C Reactive Protein ELISA Kit since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Evolutionary Biology 2021Quote: ... and eluted in 10 μL prewarmed 65°C provided elution buffer (Zymo). Six μL of each were then combined and sequenced off the U2 region via Illumina amplicon sequencing ...
-
bioRxiv - Evolutionary Biology 2021Quote: ... and eluted in 10 μL prewarmed 65°C provided elution buffer (Zymo). Six μL of each were then combined and sequenced off the U2 region by Illumina sequencing on one lane of HiSeq4000 SR50 at the QB3 Genomics Sequencing Laboratory at UC Berkeley.
-
bioRxiv - Molecular Biology 2023Quote: ... for 30min at 30°C followed by column purification (Zymo research, R1016). The following reverse transcription (RT ...
-
bioRxiv - Neuroscience 2020Quote: ... Protein degradation was performed by adding Proteinase K (Zymo) and Qiagen Protease (Qiagen) ...
-
bioRxiv - Genomics 2021Quote: ... which were then grown overnight at 37 °C and subsequently purified (Zymo, D4200). For each step ...
-
bioRxiv - Microbiology 2022Quote: ... at 30°C for 30 min and removed by RNA Clean & Concentrator (Zymo Research). Reverse transcription reactions including the ligated RNA above ...
-
bioRxiv - Developmental Biology 2020Quote: ... 1 μL CircLigase) for 12 hours at 60°C and subsequently purified by Zymo RNA Clean & Concentrator 5 columns (100 μL sample ...
-
bioRxiv - Molecular Biology 2023Quote: ... at 37°C for two hours followed by agarose gel purification (Zymo Research, USA) and overnight ligation at 4°C (T4 DNA ligase ...
-
bioRxiv - Cell Biology 2023Quote: ... ChIP-DNA was prepared using ZymoMag Protein A beads (Zymo Research). Input samples were also prepared using 10% of chromatin samples ...
-
bioRxiv - Microbiology 2022Quote: ... Gel extraction kit and DNA purification kit were from Zymo Research ...
-
bioRxiv - Molecular Biology 2022Quote: ... Digest of the vector (1 h, 37 C) was purified from agarose gel (Zymo Research). We ligated both with an insert:vector ratio of 1:4 using Ligase (Thermo Scientific ...
-
bioRxiv - Molecular Biology 2020Quote: ... at 37 °C for 30 minutes and was cleaned using RNA Clean & Concentrator (Zymo Research).
-
bioRxiv - Developmental Biology 2024Quote: ... DNA was hydrolysed for 6 h at 37°C using DNA degradase plus (Zymo Research). Mass spectrometry quantification was performed as previously described36 in the Babraham Institute mass spectrometry facility using three individual E18.5 wild-type and three individual E18.5 Tet3 knockout embryos.
-
bioRxiv - Cell Biology 2019Quote: RNA was isolated using a commercial kit (RNAmicro kit, Zymo Research), according to the manufacturer’s instructions ...
-
bioRxiv - Molecular Biology 2021Quote: ... Reactions were incubated overnight at 16°C and were terminated using RNA Clean & Concentrator (Zymo Research). Crosslink reversal was done by irradiating the RNA with 2.5 KJ/m2 254 nm UVC using a CL-1000 crosslinker (UVP ...
-
bioRxiv - Genomics 2023Quote: ... Plasmid is extracted from the bacterial culture using a 96-well mini-prep kit (Zymo kit, Zippy 96 plasmid kit). All clones are sequenced by Sanger sequencing at the site of the barcode using primer ACTTGTGTAGCGCCAAGTGC ...
-
bioRxiv - Genetics 2019Quote: ... and gel extraction kit (Zymoclean Gel DNA Recovery Kit) were from Zymo Research ...
-
bioRxiv - Bioengineering 2022Quote: ... using a commercial kit (ZymoPURE II Plasmid Maxiprep Kit; Zymo Research Corp). HEK293Ta cells (Genecopoeia ...
-
bioRxiv - Biophysics 2021Quote: ... Plasmids used for nucleofections were purified by Zymo midiprep kit (Zymo D4200) and concentrations were quantified by absorption at 260 nm ...
-
bioRxiv - Synthetic Biology 2023Quote: ... coli Transformation Kit (Zymo).
-
bioRxiv - Biophysics 2023Quote: ... Plasmids were purified by Zymo midiprep kit (Zymo D4200) and all cloning was confirmed by Sanger sequencing ...
-
bioRxiv - Microbiology 2023Quote: ... coli Transformation Kit (Zymo).
-
bioRxiv - Cancer Biology 2021Quote: ... incubated at 37 °C for 30min and column purified using the RNA Clean and Concentrator-5 (Zymo) according to the manufacturer’s instructions ...
-
bioRxiv - Molecular Biology 2022Quote: ... ZymoPure Plasmid Midiprep kit and RNA Clean & Concentrator kit were purchased from Zymo Research ...
-
bioRxiv - Microbiology 2023Quote: ... RNA was isolated using a commercial kit (DirectZol RNA Miniprep kit, Zymo Research) following manufacturer instructions ...
-
bioRxiv - Biochemistry 2023Quote: ... ZymoPURE II Midiprep Kit or the ZymoPURE II Maxiprep Kit (all Zymo Research).
-
bioRxiv - Immunology 2023Quote: ... the RNeasy Plus kit (specifically, the Quick RNA miniprep plus kit, Zymo, USA) was utilized and RNA was quantitated with Qubit RNA HS (High Sensitivity ...
-
bioRxiv - Molecular Biology 2023Quote: ... DNA and RNA were extracted using commercial kits: Quick-DNA-fungal/bacterial MiniPrep™ kit (ZymoResearch) was used for DNA and Quick-RNA-fungal/bacterial MiniPrep™ kit (Zymo Research) was used for RNA ...
-
bioRxiv - Synthetic Biology 2022Quote: ... coli using GeneJet plasmid miniprep kit (ThermoScientific) or ZymoPURE plasmid midiprep kit (Zymo Research). Sequences of all plasmids were confirmed using Sanger sequencing performed by Eurofins Genomics ...
-
bioRxiv - Microbiology 2023Quote: ... coli using GeneJet plasmid miniprep kit (ThermoScientific) or ZymoPURE plasmid midiprep kit (Zymo Research). Sequences of all plasmids were confirmed using Sanger sequencing performed by Eurofins Genomics ...
-
bioRxiv - Microbiology 2024Quote: ... The three PCR fragments were purified (Zymo DNA Clean and Concentrator kit: ‘Zymo kit’) and used in a 1:1:1 molar ratio Golden Gate assembly reaction with BsaI (NEB ...
-
bioRxiv - Genomics 2022Quote: ... followed by max speed centrifugation at 4 °C for 5 minutes and DNA purification by column purification (Zymo) prior to sample preparation for next-generation sequencing.
-
bioRxiv - Genomics 2023Quote: ... worms were thawed at 4°C and subsequently preserved in DNA/RNA Shield (Zymo Research, Irvine, CA, USA). Adults of T ...
-
bioRxiv - Evolutionary Biology 2023Quote: ... for 30 minutes at 37 °C and products were further cleaned with RNA clean & concentrator 5 (Zymo Research) and eluted with 8-10 µl RNase free water ...
-
bioRxiv - Microbiology 2021Quote: ... coli transformation kit (Zymo Research) or standard electro-transformation protocols ...
-
bioRxiv - Neuroscience 2020Quote: ... or MiniPrep Kit (R2052, Zymo Research ...
-
bioRxiv - Synthetic Biology 2020Quote: ... coli Transformation Kit (Zymo Research).
-
bioRxiv - Synthetic Biology 2021Quote: ... coli Transformation Kit from Zymo Research (Irvine ...
-
bioRxiv - Genomics 2021Quote: ... the RCC kit (Zymo Research).
-
bioRxiv - Developmental Biology 2020Quote: ... or Quick-RNA kit (Zymo). Reverse transcription was carried out by using the High-Capacity RNA-to-cDNA Kit (ThermoFisher) ...
-
bioRxiv - Synthetic Biology 2023Quote: ... coli Transformation Kit (Zymo Research). For each transformation ...
-
bioRxiv - Developmental Biology 2023Quote: ... and RNA purification kit (Zymo). cDNA was generated using Maxima First Strand cDNA synthesis kit (Thermo Fisher Scientific) ...
-
bioRxiv - Genetics 2023Quote: ... ZymoPure Midiprep Kit (Zymo Research) was used to prepare donor constructs for embryo injection ...
-
bioRxiv - Microbiology 2024Quote: ... Correct amplicons were isolated by Zymo PCR purification kit (Zymo Research). The PCR products were cloned into a PCR linearized pEcgRNA-guide plasmid to make the pEcgRNA-guide-RT plasmid using In-fusion® HD-cloning kit (Takara Bio ...
-
bioRxiv - Synthetic Biology 2024Quote: ... coli Transformation Kit (Zymo Research), and transformations were carried out using 50 ng of ligation product or plasmid ...
-
bioRxiv - Cancer Biology 2024Quote: ... coli Transformation Kit (Zymo Research). Plasmids were prepared following standard protocols ...
-
bioRxiv - Biochemistry 2021Quote: ... Zyppy™ Plasmid Miniprep kit and DNA Clean & Concentrator™ kit were purchased from Zymo Research ...
-
bioRxiv - Developmental Biology 2020Quote: ... Total RNA was isolated from using DNA/RNA Duet Kit miniprep kit (Zymo Research, USA).
-
bioRxiv - Genetics 2022Quote: ... cerevisiae temperature-sensitive strain TSA64 en masse using EZ Kit Yeast Transformation kit (Zymo Research). The entire transformed library was grown in selective media (YPD + clonNAT ...
-
bioRxiv - Genetics 2024Quote: ... cerevisiae double mutant strain sml1Δ rad53Δ using the EZ Kit Yeast Transformation kit (Zymo Research) to obtain ∼1,000,000 clones per region ...