Labshake search
Citations for Zymo Research :
251 - 300 of 2450 citations for Pops Hrms Hch Clean Up Spike 13C6 99% 50X Stock 1 Ug Ml In Nonane since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Molecular Biology 2021Quote: ... and concentrated (DNA Clean and Concentrator kit, Zymo) for multiplex sequencing on the NextSeq500 (Illumina ...
-
bioRxiv - Molecular Biology 2021Quote: ... purified by DNA Clean & Concentrator kit (Zymo Research) and then ligated into 50 ng NotI+BamHI-digested pBRα or pACλCI using T4 ligase (NEB ...
-
bioRxiv - Biochemistry 2022Quote: ... samples were purified using Clean and concentrator (Zymo).
-
bioRxiv - Genomics 2022Quote: ... was purified with DNA Clean & Concentrator (ZYMO Research) and checked by gel electrophoresis and analysis on NanoDrop™ 2000 Spectrophotometer ...
-
bioRxiv - Neuroscience 2023Quote: ... and purified with RNA Clean & Concentrator (Zymo Research). PCR products were amplified using Allen Brain Institute-derived reference primer sequences and cloned into pCR 2.1 TOPO (Invitrogen) ...
-
bioRxiv - Microbiology 2022Quote: ... using RNA Clean & Concentrator-5 (Zymo Research Inc.) for the first cleanup after the RiboFree® depletion step (according to Appendix E) ...
-
bioRxiv - Systems Biology 2023Quote: ... the RNA Clean and Concentrator-5 kit (Zymo) was used to obtain pure total RNA ...
-
bioRxiv - Developmental Biology 2023Quote: Zymo DNA Clean & Concentrator-5 (D4014, ZYMO research) was used to extract the genomic DNA in the supernatant retained after C1 beads purification ...
-
bioRxiv - Microbiology 2023Quote: ... purified with DNA Clean and Concentrator-5 (Zymo), and eluted into 20 μL final volume with water ...
-
bioRxiv - Microbiology 2023Quote: ... using RNA concentrate and clean kit (ZYMO lnc.).
-
bioRxiv - Developmental Biology 2023Quote: ... or the DNA Clean & Concentrator Kit (Zymo Research). For RNA isolation ...
-
bioRxiv - Microbiology 2023Quote: ... isolated using DNA Clean & Concentrator-5 (Zymo Research) then ligated using T4 DNA Ligase (New England BioLabs Inc.) ...
-
bioRxiv - Genomics 2023Quote: ... The sample was then column purified by Zymo DNA Clean & Concentrator-25 kit (Zymo Research, D4033) and eluted in 50 μl of dNase/RNase-free water to yield recovered viral DNA.
-
bioRxiv - Cancer Biology 2023Quote: ... Then the DNA Clean & Concentrator-5 (Zymo Research) and the Infinium HD FFPE DNA Restore Kit (Illumina ...
-
bioRxiv - Biochemistry 2023Quote: ... RNA then was purified (RNA Clean & Concentrator, Zymo), quality assessed by TapeStation analysis (Agilent) ...
-
bioRxiv - Genomics 2023Quote: ... The DNA Clean & Concentrator-5 kit (Zymo, D4013) was used to recover biotinylated gDNA ...
-
bioRxiv - Cancer Biology 2023Quote: ... and the Oligo Clean and Concentrator Kit (Zymo). cDNA was mixed 1:1 with 2x sample loading buffer ...
-
bioRxiv - Physiology 2023Quote: ... an RNA Clean & Concentrator-25 kit (Zymo, R1017) was used to increase the purity of the sample ...
-
bioRxiv - Developmental Biology 2023Quote: ... purified (RNA Clean & Concentrator Kit, Zymo Research Corporation), and reverse transcribed into cDNA (iScript cDNA Synthesis Kit ...
-
bioRxiv - Developmental Biology 2023Quote: ... and purified with RNA Clean & Concentrator (Zymo Research). cDNA was prepared from 2 µg of the RNA using oligo-dT primer and SuperScript IV First-Strand Synthesis System (Invitrogen) ...
-
bioRxiv - Developmental Biology 2023Quote: ... cleaned (RNA Clean and Concentrator, Zymo Research R1013) and aliquoted to 1 µg/µL in RNAse-free water at -80 °C for storage (concentration was determined using a Qubit 3 Fluorometer ...
-
bioRxiv - Molecular Biology 2024Quote: ... and purified by Zymo oligo clean and concentrator kit (Zymo, cat # D4060). RNAs were synthesized by in-vitro transcription (IVT ...
-
bioRxiv - Molecular Biology 2024Quote: ... Zymo DNA Clean & Concentrator kit (Zymo Research, R1060), GndHCl buffer (7.3 M guanidinium chloride ...
-
bioRxiv - Evolutionary Biology 2022Quote: ... as well as 1 Unit (0.2μL of 5U/μL stock solution) of Zymolyase (Zymo research #E1004). Libraries were prepared using the method described by Baym et al86 and sequenced on the Illumina HiSeq4000 platform ...
-
bioRxiv - Molecular Biology 2021Quote: ... The reverse cross-linked samples were treated with 20 μg/ml Proteinase K and purified using ChIP DNA Clean and Concentrator kit (Zymo research). The three reactions per condition were pooled at this stage ...
-
bioRxiv - Genomics 2020Quote: ... 5 µl reactions were purified with the ZR-96 Oligo Clean & Concentrator and 15 µl reactions were purified with the Oligo Clean & Concentrator kit (Zymo Research) and eluted with probe resuspension buffer ...
-
bioRxiv - Developmental Biology 2022Quote: ... Fragments were amplified using overhang primers (Supplementary table 1) and purified using DNA Clean & Concentrator kit (Zymo Research). The pUC19-iTol2 backbone was digested with BamHI-HF (NEB ...
-
bioRxiv - Genomics 2023Quote: ... for 1 hour at room temperature followed by isolation with a RNA Clean & Concentrator-25 kit (Zymo Research). 1 µg RNA was converted to ribosomal depleted cDNA libraries ready for sequencing using the TruSeq Stranded Total RNA Library Prep Human/Mouse/Rat kit (Illumina ...
-
bioRxiv - Plant Biology 2020Quote: ... and RNA Clean & Concentrator-25 Kit (R1018; Zymo Research). RNA samples are processed by BGI and libraries are sequenced with BGISEQ-500 sequencing platform ...
-
bioRxiv - Cancer Biology 2021Quote: ... and purified using RNA clean and concentrator (Zymo Research). Cells were then transfected with sgRNA and the EnGen Cas9 NLS protein (NEB ...
-
bioRxiv - Genetics 2021Quote: ... and purified using the RNA Clean & Concentrator kit (Zymo). All constructs generated in this study are available at https://www.addgene.org/James_Gagnon/.
-
bioRxiv - Genetics 2021Quote: ... and purified using the RNA Clean & Concentrator kit (Zymo), or by using phenol chloroform RNA extraction ...
-
bioRxiv - Molecular Biology 2021Quote: ... RNA was purified using RNA Clean & Concentrator (Zymo Research). Each RNA sample was split in two ...
-
bioRxiv - Molecular Biology 2021Quote: ... RNA was cleaned using RNA Clean & Concentrator (Zymo Research) following the manufacturer protocol for capturing RNA bigger than 200 nucleotides.
-
bioRxiv - Evolutionary Biology 2021Quote: ... PCR products were purified (Zymo DNA Clean & Concentrator kit) and then combined ...
-
bioRxiv - Evolutionary Biology 2021Quote: ... The reactions were purified again (Zymo DNA Clean & Concentrator) and pooled ...
-
bioRxiv - Microbiology 2022Quote: ... and then purified with RNA Clean & Concentrator (Zymo Research). The purified ssDNA was mixed with forward primer (5’-AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCG ATCT-3’ ...
-
bioRxiv - Microbiology 2022Quote: ... and then purified with RNA Clean & Concentrator (Zymo Research). 3’ dephosphorylation reactions included 7 µl fragmented sample ...
-
bioRxiv - Genomics 2020Quote: ... libraries were Zymo Clean & Concentrator purified (Zymo Research D4003), eluting in 15L of nuclease-free water ...
-
bioRxiv - Synthetic Biology 2020Quote: ... PCR products were column purified (Zymo DNA clean & concentrate) and digested with EcoRI and BamHI alongside digestion of the base plasmid ...
-
bioRxiv - Synthetic Biology 2020Quote: ... PCR products were column purified (Zymo DNA clean & concentrate). Successful Gibson Assembly reactions occurred using a 7:1 molar ratio of insert:backbone.
-
bioRxiv - Pharmacology and Toxicology 2020Quote: ... Following desalting using an Oligo Clean & Concentrator (Zymo Research), the polymerase reaction products were subjected to MALDI-TOF-MS (Bruker ultrafleXtreme ...
-
bioRxiv - Cell Biology 2021Quote: ... DNA was purified with CHIP clean concentrator kit (Zymo). For CHIP-qPCR ...
-
bioRxiv - Pharmacology and Toxicology 2020Quote: ... Following desalting using an Oligo Clean & Concentrator (Zymo Research), the samples were subjected to MALDI-TOF-MS (Bruker ultrafleXtreme ...
-
bioRxiv - Microbiology 2020Quote: ... and purified with RNA Clean & Concentrator-5 column (Zymo). The profiles before and after rRNA depletion were analysed with RNA 6000 pico kit (Agilent ...
-
bioRxiv - Microbiology 2020Quote: ... and purified with RNA Clean & Concentrator-5 column (Zymo). rRNA were depleted from pools using Ribo-Zero (Bacteria ...
-
bioRxiv - Microbiology 2020Quote: ... followed by RNA Clean and Concentrate kit (Zymo Researc) 24 hpi for Huh7.5 or 48 hpi for Calu-3 ...
-
bioRxiv - Genetics 2021Quote: ... purified using DNA Clean and Concentrator-5 (Zymo Research), then sequenced using shRNA_GA_R1 primer.
-
bioRxiv - Microbiology 2020Quote: ... using the RNA Clean and Concentrator kit (Zymo Research). For cDNA synthesis ...
-
bioRxiv - Genomics 2020Quote: ... followed by cleanup using RNA Clean and Concentrator (Zymo) using the manufacturer’s protocol ...