Labshake search
Citations for Zymo Research :
101 - 150 of 6112 citations for Pig Glucagon Like Peptide 2 GLP 2 CLIA Kit since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Molecular Biology 2023Quote: ... PCR products with 150-400 bp were then cut and purified with 2% agarose gel and column (Zymo research, D4008). Finally ...
-
bioRxiv - Microbiology 2023Quote: ... two agar plugs were placed in a 2 mL eppendorf tube with 500 μL of chloroform and agitated on a Genie Disruptor (Zymo) for 2 min ...
-
bioRxiv - Microbiology 2023Quote: ... two agar plugs were placed in a 2 mL eppendorf tube with 500 μL of chloroform and agitated on a Genie Disruptor (Zymo) for 2 min ...
-
bioRxiv - Microbiology 2020Quote: ... Swabbing was performed for 2 min in each site and stored in respective storage liquids (i.e. 1X PBS, pH 7.2 or Zymo DNA/RNA shield). Swabs in PBS were placed on ice and sent for culturing while the other swabs were transported back at room temperature to the laboratory and stored at -80°C ...
-
bioRxiv - Cell Biology 2021Quote: ... Spheroplasting of harvested yeast cells was performed for 2 minutes in lysis buffer (1 M sorbitol 100 mM EDTA, 0.1% β-mercaptoethanol) containing 25 units of zymolyase (Zymo Research). RNA extraction was performed with an RNeasy kit (QIAGEN ...
-
bioRxiv - Genetics 2021Quote: DNA samples ranging from 500 ng-2 μg were digested to free nucleosides using 5-15 U of DNA Degradase Plus (Zymo Research) in 25 μl reactions incubated for 2 hrs at 37 °C ...
-
bioRxiv - Immunology 2020Quote: PCR testing for SARS-CoV-2 was carried out on respiratory specimens mixed 1:1 in DNA/RNA Shield (Zymo Inc) using an in-house Clinical Laboratory Improvement Amendments (CLIA ...
-
bioRxiv - Genomics 2021Quote: ... Chronotype was assessed by computing mid-sleep time on free days (MSF).2 Participants’ stool samples were collected using DNA/RNA Shield Fecal Collection tubes (Zymo research). Sample DNA extraction was performed using the PureLink Microbiome DNA Purification Kit (Invitrogen ...
-
bioRxiv - Neuroscience 2022Quote: ... the resulting solution was incubated with 3 volumes of TRI-reagent at room temperature for 2 hours (R2050-1-50; Zymo Research). The mix was then transferred out of the BSL-3 facilities and nucleic acids were purified using the Direct-zol DNA/RNA miniprep kit (R2080 ...
-
bioRxiv - Bioengineering 2023Quote: The 2 μL of EVs were incubated at room temperature for 15 min with 1 U of DNase I (Zymo Research) and 1x DNA Digestion Buffer ...
-
bioRxiv - Molecular Biology 2023Quote: ... nojo-1 and nojo-2 complete roots of plants growing 12 DAS using Quick-RNA Miniprep (Zymo Research, Irvine, CA, USA). Complementary DNA was generated using the SuperScriptTMII Reverse Transcriptase (InvitrogenTM ...
-
bioRxiv - Systems Biology 2023Quote: ... Pools 4-8 from experimental replicate #2 were resuspended in 100 µL spheroplast digest buffer with 2.5U/mL Zymolyase T100 (Zymo Research #E1005) and incubated at 37°C for 20 minutes ...
-
bioRxiv - Neuroscience 2020Quote: ... and sorted into 384-well plates preloaded with 2μl of digestion buffer for snmC-seq215 (20 mL digestion buffer consists of 10 mL M-digestion buffer (2×, Zymo D5021-9), 1 ml Proteinase K (20 mg ...
-
bioRxiv - Microbiology 2021Quote: ... RNA was extracted from SARS-CoV-2 infected and uninfected Huh7 cells using the Direct-zol™ RNA Miniprep (Zymo Research, USA).
-
bioRxiv - Microbiology 2020Quote: ... RNA from SARS-CoV-2 infected and uninfected Huh7 cells and supernatent was extracted using the Direct-zol RNA Miniprep (Zymo Research, US) and quantitative real-time polymerase chain reaction (qRT-PCR ...
-
bioRxiv - Microbiology 2019Quote: ... and a mock microbial community DNA (8 bacterial + 2 yeasts species mixed in defined proportions) (ZymoBIOMICS Microbial Community DNA standard, Zymo Research, USA) were included in the experiments ...
-
bioRxiv - Genetics 2023Quote: ... 30 samples were collected (5 timepoints x 2 genotypes x 3 replicates) and RNA was extracted using a Direct-zol RNA Miniprep (Zymo Research R2061) using TRIzol Reagent (ThermoFisher Cat # 15596026 ...
-
bioRxiv - Zoology 2023Quote: ... cucullus vegetative cells (300,000 cells) and 2-week-old mature cysts (3,000,000 cells) using the Direct-zol RNA purification system (Zymo Research Crop., California, USA) according to the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2021Quote: ... from each pig were diluted with dextrose saline (10 g/mL) in a DNA/RNA Shield tube (Cat # R1150, Zymo Research, Irvine, CA, USA) and stored at −20°C before the experiment ...
-
bioRxiv - Microbiology 2020Quote: ... we prepared a series of 8 serial dilutions of a known mock microbial community consisting of 8 gram positive and negative bacteria and 2 yeast (Zymo Research, catalog # D6300), as previously described (31) ...
-
bioRxiv - Microbiology 2022Quote: ... 2 extracted with tissue samples and 1 run with water samples) and 2 samples of DNA from mock bacterial communities (ZymoBIOMICS Microbial Community DNA Standard, Zymo Research, Irvine CA) were prepared and sequenced ...
-
bioRxiv - Zoology 2023Quote: ... for 3 min at 28 Hz in 2 mL microcentrifuge tubes in 1X sterile PBS or four volumes of DNA/RNA Shield (Zymo Research, Irvine, CA) and two 5 mm stainless steel grinding balls ...
-
bioRxiv - Molecular Biology 2023Quote: ... Amplified samples were run on a 2% agarose gel and fragments of the correct size were purified using ADB Agarose Dissolving Buffer (Zymo D4001-1-100) and UPrep Micro Spin Columns (Genesee Scientific 88– 343) ...
-
bioRxiv - Microbiology 2020Quote: ... pH 7.2) and 3 swabs (2 for metagenomic DNA isolation, 1 for storage) moistened with DNA/RNA shield (Zymo Research, Cat. No. ZYR.R1100-250). Swabbing was performed for 2 min in each site and stored in respective storage liquids (i.e ...
-
bioRxiv - Microbiology 2021Quote: ... were drawn from the intravenous line at 1- or 2-hour intervals and collected in DNA/RNA shield (Cat# R1150, Zymo Research, Irvine, CA, USA). All procedures were approved by SNUBH IACUC (BA1804-246/040-01).
-
bioRxiv - Animal Behavior and Cognition 2021Quote: ... Punches from each of these brain regions were placed in individual tubes containing 2□mm size beads (ZR BashingBeads Lysis Tubes, Zymo Research, item S6003-50) and 1 mL of QIAzol lysis reagent (Qiagen ...
-
bioRxiv - Plant Biology 2023Quote: The expression vectors were introduced into the yeast PichiaPink™ Strain 2 using Frozen-EZ Yeast Transformation II™ (Zymo Research Co., Irvine, CA, USA). Recombinant strains were initially cultured in BMGY liquid medium at 30 °C for about 24 h ...
-
bioRxiv - Microbiology 2023Quote: ... containing a known concentration and taxonomy of 8 bacterial and 2 fungal species was also included as an internal control (Zymo Research Corp, Cat No. D6310). Extracted nucleic acids from each sample were randomized into a 96-well rack (Figure 1C ...
-
bioRxiv - Genetics 2022Quote: ... cells were synchronized in G1 phase by addition of 4 µg/mL α-factor (Zymo research, mating hormone peptide) for 2 h ...
-
bioRxiv - Microbiology 2022Quote: ... Gel extraction kit and DNA purification kit were from Zymo Research ...
-
bioRxiv - Cell Biology 2019Quote: RNA was isolated using a commercial kit (RNAmicro kit, Zymo Research), according to the manufacturer’s instructions ...
-
bioRxiv - Genomics 2023Quote: ... Plasmid is extracted from the bacterial culture using a 96-well mini-prep kit (Zymo kit, Zippy 96 plasmid kit). All clones are sequenced by Sanger sequencing at the site of the barcode using primer ACTTGTGTAGCGCCAAGTGC ...
-
bioRxiv - Genetics 2019Quote: ... and gel extraction kit (Zymoclean Gel DNA Recovery Kit) were from Zymo Research ...
-
bioRxiv - Bioengineering 2022Quote: ... using a commercial kit (ZymoPURE II Plasmid Maxiprep Kit; Zymo Research Corp). HEK293Ta cells (Genecopoeia ...
-
bioRxiv - Biophysics 2021Quote: ... Plasmids used for nucleofections were purified by Zymo midiprep kit (Zymo D4200) and concentrations were quantified by absorption at 260 nm ...
-
bioRxiv - Synthetic Biology 2023Quote: ... coli Transformation Kit (Zymo).
-
bioRxiv - Biophysics 2023Quote: ... Plasmids were purified by Zymo midiprep kit (Zymo D4200) and all cloning was confirmed by Sanger sequencing ...
-
bioRxiv - Microbiology 2023Quote: ... coli Transformation Kit (Zymo).
-
bioRxiv - Molecular Biology 2022Quote: ... ZymoPure Plasmid Midiprep kit and RNA Clean & Concentrator kit were purchased from Zymo Research ...
-
bioRxiv - Microbiology 2023Quote: ... RNA was isolated using a commercial kit (DirectZol RNA Miniprep kit, Zymo Research) following manufacturer instructions ...
-
bioRxiv - Biochemistry 2023Quote: ... ZymoPURE II Midiprep Kit or the ZymoPURE II Maxiprep Kit (all Zymo Research).
-
bioRxiv - Immunology 2023Quote: ... the RNeasy Plus kit (specifically, the Quick RNA miniprep plus kit, Zymo, USA) was utilized and RNA was quantitated with Qubit RNA HS (High Sensitivity ...
-
bioRxiv - Molecular Biology 2023Quote: ... DNA and RNA were extracted using commercial kits: Quick-DNA-fungal/bacterial MiniPrep™ kit (ZymoResearch) was used for DNA and Quick-RNA-fungal/bacterial MiniPrep™ kit (Zymo Research) was used for RNA ...
-
bioRxiv - Synthetic Biology 2022Quote: ... coli using GeneJet plasmid miniprep kit (ThermoScientific) or ZymoPURE plasmid midiprep kit (Zymo Research). Sequences of all plasmids were confirmed using Sanger sequencing performed by Eurofins Genomics ...
-
bioRxiv - Microbiology 2023Quote: ... coli using GeneJet plasmid miniprep kit (ThermoScientific) or ZymoPURE plasmid midiprep kit (Zymo Research). Sequences of all plasmids were confirmed using Sanger sequencing performed by Eurofins Genomics ...
-
bioRxiv - Microbiology 2024Quote: ... The three PCR fragments were purified (Zymo DNA Clean and Concentrator kit: ‘Zymo kit’) and used in a 1:1:1 molar ratio Golden Gate assembly reaction with BsaI (NEB ...
-
bioRxiv - Microbiology 2021Quote: ... coli transformation kit (Zymo Research) or standard electro-transformation protocols ...
-
bioRxiv - Neuroscience 2020Quote: ... or MiniPrep Kit (R2052, Zymo Research ...
-
bioRxiv - Synthetic Biology 2020Quote: ... coli Transformation Kit (Zymo Research).
-
bioRxiv - Synthetic Biology 2021Quote: ... coli Transformation Kit from Zymo Research (Irvine ...