Labshake search
Citations for Zymo Research :
1 - 50 of 6060 citations for Mouse Short Coiled Coil Protein SCOC ELISA Kit since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cancer Biology 2022Quote: ... was used for the estimation of global 5-hmC and 5-mC levels by ELISA using the Quest 5-hmC ELISA kit and the 5-mC DNA ELISA kit (Zymo research Inc, USA) according to the manufacturer’s instructions.
-
bioRxiv - Molecular Biology 2022Quote: ... measured with the 5mC ELISA kit (Zymo Research), to 12 % of the total human 5-methylated cytosine (5mC ...
-
bioRxiv - Microbiology 2022Quote: ... Genomic DNA extractions for short read sequencing were prepared using the Quick-DNA Miniprep Plus Kit (Zymo Research). High molecular weight genomic DNA extractions were prepared using the Monarch HMW DNA Extraction Kit for Tissue (NEB) ...
-
bioRxiv - Microbiology 2023Quote: ... long RNA species (>200bp) were separated from short ones (<200) using RNA Clean & Concentrator-5 kit (Zymo, R1013).
-
bioRxiv - Evolutionary Biology 2023Quote: A second DNA extraction was performed for short read libraries using a YeaStar Genomic DNA Kit (Zymo Research). Libraries were generated using the Nextera DNA Flex Library Prep kit (Illumina ...
-
bioRxiv - Genomics 2020Quote: ... Genomic DNA for short-read sequencing was extracted from 80-100 mg of fungal tissue with the Fungal/Bacterial Microprep kit (Zymo; www.zymo.com). Paired-end libraries were prepared and sequenced using the Illumina HiSeq X (150-bp-long ...
-
bioRxiv - Microbiology 2024Quote: For short read Illumina sequencing DNA extractions were carried out with the Quick-DNA Fungal/Bacterial Miniprep Kit (Zymo Research, UK), with the addition for S ...
-
bioRxiv - Genetics 2019Quote: ... Genomic DNA was used for global (5-mC DNA ELISA Kit -Zymo Research) and specific (satellite I region – BS-PCR ...
-
bioRxiv - Neuroscience 2023Quote: Genome-wide DNA methylation levels were determined using the 5-mC DNA ELISA Kit (Zymo Research, D5325) per the manufacturer’s instruction ...
-
bioRxiv - Cell Biology 2023Quote: Global DNA methylation was performed in genomic DNA using 5-mC DNA ELISA kit (Zymo Research, USA) following manufacturer’s protocol and that described in (Valdivieso et al. ...
-
bioRxiv - Plant Biology 2023Quote: ... Relative quantification of 5-methylcytosine (5-mC) over time was determined using the 5-mC DNA ELISA Kit (Zymo Research), using 100 ng of genomic DNA per sample as input ...
-
bioRxiv - Microbiology 2019Quote: ... The cells were harvested and the protein was purified using His-Spin Protein Miniprep kit (Zymo Research) according to the manufacturer’s instructions ...
-
bioRxiv - Genetics 2019Quote: Genomic DNA samples were also used for global DNA methylation analysis using the 5-mC DNA ELISA Kit (Zymo Research, Irvine, CA, USA) according to manufacturer’s protocol ...
-
bioRxiv - Cell Biology 2020Quote: ... and primary mouse keratinocytes was isolated using Direct-zol RNA Microprep Kits (Zymo) according to the manufacturer’s instructions ...
-
bioRxiv - Immunology 2020Quote: RNA from mouse lungs was extracted using RNA Miniprep Plus Kit (Zymo Research). Briefly ...
-
bioRxiv - Cell Biology 2023Quote: gDNA was isolated from mouse gastrocnemius using Quick-DNA Microprep Plus Kit (Zymo D4074). gDNA was amplified using CloneAmp™ HiFi PCR Premix (Takara 639298 ...
-
bioRxiv - Immunology 2022Quote: pAd/S1RS09cg proteins were amplified and purified using ZymoPURE II plasmid maxiprep kit (Zymo Research). For Expi293 cell transfection ...
-
bioRxiv - Biochemistry 2023Quote: ... and the DNAs were purified away from protein using a DNA Clean & Concentrator kit (Zymo Research). Both 5’ ends of 1 pmole of the CRISPR leader and array fragments were then labelled with 32P ...
-
bioRxiv - Cell Biology 2022Quote: ... and total RNA of mouse organoids was isolated using Quick-RNA Miniprep Plus Kit (Zymo Research), and all of them were assessed for purity and quantity using a Nanodrop 1000 spectrophotometer ...
-
bioRxiv - Molecular Biology 2021Quote: ... pLXSP-16E7 or control vector infected primary mouse keratinocytes with the Quick-RNA Miniprep kit (Zymo Research). cDNA was synthesized with the Quantinova Reverse Transcription Kit (Qiagen) ...
-
bioRxiv - Cell Biology 2021Quote: RNA was extracted from mouse hearts using either the Direct-zol RNA Miniprep kit (Zymo, cat# R2051) or the RNeasy Fibrous Tissue Mini Kit (QIAGEN ...
-
bioRxiv - Neuroscience 2023Quote: Total RNA was isolated from mouse hippocampus with the Quick-RNA Miniprep Plus Kit (Zymo Research, R1058) and RNA integrity was determined using Agilent Bioanalyzer ...
-
bioRxiv - Molecular Biology 2021Quote: Genomic DNA (400 ng) from mouse tail was bisulphite converted with the EZ DNA Methylation-Lightning kit (Zymo Research ...
-
bioRxiv - Molecular Biology 2019Quote: Total RNA was prepared from fibroblasts isolated from mouse hearts using Direct-zol RNA miniprep kit (Zymo Research). cDNA libraries were prepared using the NEBNext Ultra Directional Library Preparation Kit following rRNA depletion using the NEB rRNA depletion kit ...
-
bioRxiv - Molecular Biology 2024Quote: Mouse back skin was homogenized and RNA was extracted using Quick-RNA Miniprep Kit (Zymo Research, Cat# R1054) per the manufacturer’s instructions ...
-
bioRxiv - Neuroscience 2022Quote: ... Then the nucleic-acid bound protein isolation was performed using buffers from the Quick-RNA Miniprep Kit (Zymo Research) and the Zymo-Spin IIICG Column (Zymo Research) ...
-
bioRxiv - Cell Biology 2023Quote: ... Endogenous RNA cross-linked to bait protein was recovered from the beads using the QuickRNA Microprep Kit (Zymo Research). Complementary DNA was synthesized using the SuperScript III First-Strand Synthesis kit (Invitrogen ...
-
bioRxiv - Genomics 2023Quote: ... DNA was captured on protein A/G agarose beads and purified using the ChIP DNA Clean & Concentrator kit (Zymo) and used for qPCR ...
-
bioRxiv - Bioengineering 2020Quote: ... Total RNA was extracted from mouse tissues and HEK293 cells using Quick-RNA MiniPrep Kit (ZYMO Research, Irvine, CA). Five μg of treated RNA was used as template for first-strand cDNA synthesis by using RevertAid RT Reverse Transcription Kit (Life Technologies ...
-
bioRxiv - Cell Biology 2022Quote: RNA was isolated from mouse iBAT following the standard protocol for the Direct-zol RNA Miniprep kit (Zymo Research) and assessed for quality on the Agilent 2200 TapeStation (Agilent Technologies) ...
-
bioRxiv - Systems Biology 2022Quote: Total RNA was extracted from mouse kidneys and livers by the Direct-zol™ RNA Purification Kits (Zymo Research). Purified RNA was reverse transcribed using the SuperScript™ IV First-Strand Synthesis System (Thermo Fisher Scientific) ...
-
bioRxiv - Microbiology 2020Quote: ... Combination of the two plasmids encoding the desired fusion proteins were transformed into Y2HGold cells using Frozen-EZ Yeast Transformation II Kit (Zymo Research). Selection for growth was carried out on selective drop-out plates lacking leucine and tryptophan (SD-Leu-Trp ...
-
bioRxiv - Plant Biology 2024Quote: ... was used to pull-down the protein/DNA complexes and DNA was purified using ChIP Clean-up and Concentrator kit (Zymo Research). Libraries were constructed using Ultra II DNA kit (NEB).
-
bioRxiv - Molecular Biology 2022Quote: ... 4sU-labelled mouse and Drosophila cells were mixed and RNA was extracted using the Direct-zol DNA/RNA Miniprep kit (Zymo Research) as per the manufacturer’s protocol ...
-
bioRxiv - Genetics 2019Quote: ... genomic DNA was isolated from a small aliquot of mixed mouse and fly cells using Quick-DNA Miniprep kit (Zymo Research) according to the manufacturer’s protocol ...
-
bioRxiv - Molecular Biology 2023Quote: Total RNA was extracted from human iPSC-FBs and mouse Raw 264-7 cells using the Direct-Zol RNA kit (Zymo Research) according to manufacturer instructions ...
-
bioRxiv - Bioengineering 2022Quote: ... Total RNA was then isolated from all mouse tissues using TRIzol reagent and RNA Isolation kits with on-column DNase treatment (Zymo Cat# R2072). cDNA synthesis was performed with random primers from the Protoscript cDNA synthesis kit (NEB Cat#E6560S) ...
-
bioRxiv - Bioengineering 2022Quote: Yeast competent cells were transformed with polycistronic constructs containing fluorescent proteins using the Frozen-EZ yeast transformation II kit (Zymo Research, Irvine, CA) according to the manufacturer’s protocol ...
-
bioRxiv - Biochemistry 2020Quote: ... then loaded directly onto a Ni-NTA protein miniprep column (His Spin Protein Miniprep, Zymo Research). Protein was washed following the manufacturer’s instructions ...
-
bioRxiv - Developmental Biology 2021Quote: ... or Universal Methylated Mouse DNA Standard (Zymo Research) was bisulfite converted using EZ DNA Methylation-GoldTM Kit (Zymo Research) ...
-
bioRxiv - Neuroscience 2020Quote: ... Protein degradation was performed by adding Proteinase K (Zymo) and Qiagen Protease (Qiagen) ...
-
bioRxiv - Molecular Biology 2020Quote: ... Universally methylated mouse DNA standard (cat. no. D5012, Zymo Research) and Mlh1−/− tissues were used as Mlh1+/+ and Mlh1−/− allele controls ...
-
bioRxiv - Cell Biology 2023Quote: ... ChIP-DNA was prepared using ZymoMag Protein A beads (Zymo Research). Input samples were also prepared using 10% of chromatin samples ...
-
bioRxiv - Microbiology 2022Quote: ... Gel extraction kit and DNA purification kit were from Zymo Research ...
-
bioRxiv - Cell Biology 2019Quote: RNA was isolated using a commercial kit (RNAmicro kit, Zymo Research), according to the manufacturer’s instructions ...
-
bioRxiv - Genomics 2023Quote: ... Plasmid is extracted from the bacterial culture using a 96-well mini-prep kit (Zymo kit, Zippy 96 plasmid kit). All clones are sequenced by Sanger sequencing at the site of the barcode using primer ACTTGTGTAGCGCCAAGTGC ...
-
bioRxiv - Molecular Biology 2020Quote: ... Universally methylated mouse DNA standard (cat. no. D5012, Zymo Research, Irvine, CA) and genomic DNA extracted from normal spleen was used as positive and negative controls ...
-
bioRxiv - Genetics 2019Quote: ... and gel extraction kit (Zymoclean Gel DNA Recovery Kit) were from Zymo Research ...
-
bioRxiv - Bioengineering 2022Quote: ... using a commercial kit (ZymoPURE II Plasmid Maxiprep Kit; Zymo Research Corp). HEK293Ta cells (Genecopoeia ...
-
bioRxiv - Biophysics 2021Quote: ... Plasmids used for nucleofections were purified by Zymo midiprep kit (Zymo D4200) and concentrations were quantified by absorption at 260 nm ...