Labshake search
Citations for Zymo Research :
151 - 200 of 487 citations for Human METTL3 shRNA Plasmid since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2023Quote: ... Plasmid DNA was purified for transfection into mammalian cell lines using a ZymoPURE II Plasmid Maxiprep Kit (Zymo Research).
-
bioRxiv - Biochemistry 2023Quote: ... These cells were cultured in LB media and plasmids were purified using ZymoPURE II Plasmid Midiprep kit (Zymo Research). Each plasmid was then digested with EcoRI-HF and BamHI-HF (NEB ...
-
bioRxiv - Genetics 2023Quote: ... C shaker for 12h-16h prior to harvesting for plasmid purification using ZymoPURE II Plasmid Midiprep kit (Zymo D4200). Based on the colony forming units from the small volumes in the bacterial plates ...
-
bioRxiv - Bioengineering 2024Quote: ... plasmid Homology Directed Repair Templates were produced by bacterial culture and standard plasmid preparation (Zymo Midiprep and Maxiprep kits) according to manufacturer instructions ...
-
bioRxiv - Synthetic Biology 2024Quote: ... Colonies were scraped with 2XYT and plasmid DNA extracted with the ZymoPURE II Plasmid Maxiprep Kit (Zymo Research, D4203); the extracted plasmid DNA was then precipitated with isopropanol ...
-
bioRxiv - Evolutionary Biology 2021Quote: ... bacterial colonies were selected and grown in overnight cultures for plasmid purification using the Zyppy Plasmid Miniprep kit (Zymo Research). Sanger sequencing of clones was performed using M13F and M13R primers ...
-
bioRxiv - Molecular Biology 2020Quote: ... The plasmids with the A/B standards were then extracted and purified using the ZymoPURE Plasmid Miniprep Kit (Zymo Research), according to the manufacturer’s protocol ...
-
bioRxiv - Biophysics 2019Quote: ... Plasmid were isolated using an E.Z.N.A Plasmid MiniPrep Kit (Omega Bio-teck; Norcross, GA) or a ZymoPure II Plasmid Midiprep Kit (Zymo Research; Irvine, CA) per manufactures recommendations ...
-
bioRxiv - Synthetic Biology 2021Quote: ... cell debris was spun down and plasmid DNA was collected using the Zymo Zyppy plasmid preparation kit (Zymo Research, D4036) according to the manufacturer’s instructions ...
-
bioRxiv - Cell Biology 2021Quote: ... Transfection-grade plasmid DNA was isolated from each flask using the ZymoPURE II Plasmid Maxiprep Kit (Zymo Research, Irvine, CA) according to the manufacturer’s instructions ...
-
bioRxiv - Immunology 2023Quote: ScFv encoding plasmids were recovered from yeast cultures by miniprep with the Zymoprep yeast plasmid miniprep II kit (Zymo Research) as previously described(42) ...
-
bioRxiv - Microbiology 2023Quote: ... PCR purification and plasmid isolation was done using the DNA Clean & Concentrator-5 and Zyppy Plasmid Miniprep Kits from Zymo Research ...
-
bioRxiv - Cell Biology 2023Quote: ... and 100-mL maxiprep cultures of the plasmid-expressing bacteria were grown and purified by ZymoPure plasmid kits (Zymo Research). Each purification of the pTRIPZ-OGT-FH plasmid was resolved by 1% agarose gel to ensure no recombination occurred.
-
bioRxiv - Genomics 2023Quote: ... 3 colonies were randomly selected and further expanded for plasmid DNA purification (Zyppy™ Plasmid Purification Kit; Zymo research #D4019). Extracted DNA was then sequenced to verify the integrity of the cloned fragments.
-
bioRxiv - Genomics 2023Quote: ... Plasmid is extracted from the bacterial culture using a 96-well mini-prep kit (Zymo kit, Zippy 96 plasmid kit). All clones are sequenced by Sanger sequencing at the site of the barcode using primer ACTTGTGTAGCGCCAAGTGC ...
-
bioRxiv - Synthetic Biology 2024Quote: DNA templates for expression in PUREfrex were prepared either in plasmid form using ZymoPURE II Plasmid Midiprep Kit (Zymo Research) or as linear expression templates (LETs) ...
-
bioRxiv - Biophysics 2021Quote: ... Plasmids used for nucleofections were purified by Zymo midiprep kit (Zymo D4200 ...
-
bioRxiv - Bioengineering 2021Quote: ... Plasmid DNA was purified by miniprep (Zymo Research). Double stranded preamplifier synthesis template was synthesized by PCR using LongAmp PCR polymerase (NEB) ...
-
bioRxiv - Molecular Biology 2022Quote: ... purified using ZymoPURE Plasmid Miniprep Kit (Zymo Research) and sequenced ...
-
bioRxiv - Microbiology 2020Quote: ... using the Zyppy Plasmid Miniprep kit (Zymo Research). Nested primers within the amplified flanking regions were used to stitch the flanks and resistance cassette together ...
-
bioRxiv - Synthetic Biology 2020Quote: ... and plasmid prep kits were purchased from Zymo Research and used according to provided protocols ...
-
bioRxiv - Bioengineering 2019Quote: ... Zyppy Plasmid MiniPrep Kit was purchased from Zymo Research ...
-
bioRxiv - Synthetic Biology 2020Quote: ... The ZymoPURE II Plasmid Midiprep Kit (D4200, Zymo) was used for DNA library extractions ...
-
bioRxiv - Cancer Biology 2021Quote: ... resulting plasmids are transfected into competent cells (Zymo Mix & Go! Competent Cells Zymo 10B #T3019) ...
-
bioRxiv - Synthetic Biology 2021Quote: ... purified using ZyppyTM Plasmid Miniprep kit (Zymo Research), and sequence verified by Sanger sequencing (Genewiz).
-
bioRxiv - Microbiology 2020Quote: ... Plasmids were purified (ZymoPURE mini-prep, Zymo Research) and verified by DNA sequencing before transformation of chemically competent BL21-AI E ...
-
bioRxiv - Microbiology 2023Quote: ... Plasmids were miniprepped from the resulting colonies (Zymo) and Sanger sequenced (Quintara Biosciences).
-
bioRxiv - Molecular Biology 2023Quote: ... and ZymoPURE Plasmid Miniprep kit were from Zymo Research (Irvine ...
-
bioRxiv - Neuroscience 2019Quote: ... Methylated and unmethylated human gDNAs (Zymo Research, Irvine, CA) were bisulfite-converted using the EZ DNA Methylation-Gold kit (Zymo Research ...
-
bioRxiv - Genomics 2021Quote: ... The Human Methylated & Non-methylated DNA Set (ZYMO Research) was used to generate DNA methylation standards ...
-
bioRxiv - Molecular Biology 2021Quote: ... one each with the insert in genomic and in antigenomic orientation for plasmid stock preparation using ZymoPURE II Plasmid Maxiprep Kit (Zymo Research).
-
bioRxiv - Microbiology 2020Quote: ... The Variovorax CL14 genes contained in Vectors 1 and 2 were inferred by isolating plasmid from these clones using the ZymoPURE II Plasmid Midiprep Kit (Zymo Research) and Sanger sequencing the insert ends using primers JMC247 and JMC270 (Supplementary Table 19) ...
-
bioRxiv - Developmental Biology 2022Quote: ... Glycerol stocks of the plasmids that were confirmed correct by Sanger sequencing were grown and prepared for maxiprep plasmid isolation (Zyppy Plasmid Maxiprep Kit, Zymo 6431). Proper cloning was achieved for all gRNAs.
-
bioRxiv - Immunology 2021Quote: DNA was extracted from yeast libraries using Zymoprep-96 Yeast Plasmid Miniprep kits or Zymoprep Yeast Plasmid Miniprep II kits (Zymo Research) according to standard manufacturer protocols ...
-
bioRxiv - Immunology 2021Quote: ... DNA was extracted from the yeast library using Zymoprep-96 Yeast Plasmid Miniprep kits or Zymoprep Yeast Plasmid Miniprep II kits (Zymo Research) according to standard manufacturer protocols ...
-
bioRxiv - Immunology 2021Quote: scFv encoding plasmids were recovered from yeast cultures by yeast miniprep with the Zymoprep yeast plasmid miniprep II kit (Zymo Research). Isolated DNA was transformed into NEB5α strain of E ...
-
bioRxiv - Immunology 2021Quote: ... and enriched yeast plasmid libraries were extracted using Zymoprep Yeast Plasmid Miniprep II kit according to the manufacturer’s instructions (Zymo Research D2004).
-
bioRxiv - Physiology 2022Quote: ... validated clones were amplified in a large scale (150 ml) and the plasmid DNA was isolated using ZymoPURE Plasmid Maxiprep kit (Zymo Research). Endotoxin was eliminated by treating the plasmid with Endozero columns (Zymo Research).
-
bioRxiv - Microbiology 2022Quote: ... coli TOP10 cells were propagated in LB medium (ampicillin, 100 µg/ml) and used for recombinant plasmid DNA isolation (Zypy Plasmid Miniprep, Zymo Research). Prior to plasmid transformation to expression host E ...
-
bioRxiv - Genomics 2023Quote: ... All colonies from each reaction were scraped from the plate and the CROP-seq-opti-Puro-T2A-GFP-sgRNA plasmid library was extracted using ZymoPURE II Plasmid Midiprep Kit (Zymo, D4200). The lentiviral library was generated as stated above with extended virus production time ...
-
bioRxiv - Genomics 2023Quote: ... was transformed with 2 uL of each ligation reaction and resulting colonies were selected for plasmid DNA isolation using the ZymoPure Plasmid miniprep kit (Zymo Research). Each cloned gRNA sequence-containing PB-CRISPRia plasmid was verified by Sanger sequencing (Quintara Bio).
-
bioRxiv - Biochemistry 2023Quote: ... All plasmids used for transient transfection experiments were purified with an endotoxin removal step (ZymoPURE Plasmid Miniprep Kit from Zymo Research). The PEmax** protein expression vector (pET-21a-PEmax**-6His ...
-
bioRxiv - Microbiology 2023Quote: ... Prototrophic colonies were grown in uracil dropout medium (MilliporeSigma) at 30 °C and 250 rpm and the plasmid was purified using the Yeast Plasmid MiniPrep II Kit (Zymo Research). The plasmid was transformed into TransforMax EPI300TM E ...
-
bioRxiv - Synthetic Biology 2024Quote: ... colonies were scraped with 50 mL 2XYT and plasmid DNA extracted with the ZymoPURE II Plasmid Maxiprep Kit (Zymo Research, D4203). These plasmid libraries constitute the “post-selection libraries.”
-
The evolution of red colour vision is linked to coordinated rhodopsin tuning in lycaenid butterfliesbioRxiv - Evolutionary Biology 2020Quote: ... Plasmid DNAs were verified by Sanger sequencing and purified with the endo-free ZymoPURE™ II Plasmid Midiprep Kit (Zymo Research, USA). Two micrograms of plasmid DNAs were used to transfect small-scale HEKT293 cultures and optimize expression conditions both via mRuby2 visualization and western blot analysis ...
-
bioRxiv - Genomics 2020Quote: ... All plasmids used in this work were freshly prepared from 50 mL of Mach1 culture using ZymoPURE Plasmid Midiprep (Zymo Research Corporation) – a kit that involves an endotoxin removal procedure ...
-
bioRxiv - Bioengineering 2022Quote: Plasmid DNA was extracted from frozen glycerol library aliquots using a Zyppy Plasmid Miniprep Kit according to manufacturer instructions (Zymo, Cat# D4036). After performing assembly selections on the double mutant libraries ...
-
bioRxiv - Biochemistry 2023Quote: ... Single colonies were grown in Sc-Ura medium for 1 d and plasmid DNA was purified using Zymoprep II Yeast plasmid Miniprep kit (Zymo Research, CA). Plasmids were then transformed into E ...
-
bioRxiv - Genomics 2023Quote: ... Single colonies were used to inoculate ampicillin liquid cultures grown overnight with shaking at 37°C and plasmids were subsequently purified with the ZR Plasmid Miniprep kit (Zymo Research #D4016). The purified plasmids were screened by Sanger sequencing (GeneWiz ...
-
bioRxiv - Cell Biology 2020Quote: ... of Zymoprep™ Yeast Plasmid Miniprep II (Zymo Research). Yeast plasmid DNA was heated at 65 °C for 20 min ...