Labshake search
Citations for Zymo Research :
351 - 400 of 6158 citations for Human Low affinity immunoglobulin gamma Fc region receptor II c FCGR2C ELISA Kit since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Biochemistry 2024Quote: ... DNA was harvested from the libraries before and after sorting using Zymoprep Yeast Plasmid Miniprep II (Zymo Research, D2004). VH sequences were amplified by PCR and submitted to Genewiz for Amplicon NGS sequencing.
-
bioRxiv - Molecular Biology 2024Quote: ... Colonies were collected with 1.5mL sterile DDW and extracted using Zymoprep Yeast Plasmid Miniprep II (Zymo Research, CAT #D2004).
-
bioRxiv - Microbiology 2022Quote: ... at 30°C for 30 min and removed by RNA Clean & Concentrator (Zymo Research). Reverse transcription reactions including the ligated RNA above ...
-
bioRxiv - Developmental Biology 2020Quote: ... 1 μL CircLigase) for 12 hours at 60°C and subsequently purified by Zymo RNA Clean & Concentrator 5 columns (100 μL sample ...
-
bioRxiv - Molecular Biology 2023Quote: ... at 37°C for two hours followed by agarose gel purification (Zymo Research, USA) and overnight ligation at 4°C (T4 DNA ligase ...
-
bioRxiv - Immunology 2024Quote: ... Bisulfite conversion was confirmed by PCR using Universal Methylated Human DNA Standard with hMLH1 Primers (Zymo Research). Converted DNA was then applied to an Illumina Infinium MethylationEPIC850 BeadChip (865918 probes ...
-
bioRxiv - Synthetic Biology 2019Quote: ... Then 1 mL of the culture was removed for DNA extraction using the Zymoprep yeast Plasmid Miniprep II (Zymo Research) kit ...
-
bioRxiv - Microbiology 2021Quote: ... used in this study has a log abundance distribution of different bacterial species and fungi ranging from 108 to 102 cells (ZymoBIOMICS Microbial Community Standard II, ZYMO RESEARCH EUROPE GMBH ...
-
bioRxiv - Genetics 2022Quote: Yeast colonies containing bait and prey constructs that grew on Trp−/Leu−/His− + 25 mM 3-Amino-1,2,4-triazole (3AT) selection plates were extracted using the Zymoprep Yeast Plasmid Miniprep II (Zymo Research, D2004) followed by Sanger sequencing for gene identification ...
-
bioRxiv - Bioengineering 2020Quote: ... Around 50 ml of yeast culture was harvested and DNA was extracted using Zymoprep Yeast Plasmid Miniprep II (Zymo Research). Two rounds of PCR were performed to amplify the coding sequence of the selected proteins and attach standard Illumina sequencing adaptors ...
-
bioRxiv - Molecular Biology 2023Quote: ... eluted RNA is spun out into fresh tubes and a second elution with water is performed (Zymo-I = 30μL, Zymo-II = 50μL, Zymo-IIICG = 60μL). To the eluate ...
-
bioRxiv - Synthetic Biology 2023Quote: ... A maximum of 96 PCR reactions were pooled at a time and cleaned with Zymo-Spin II columns (Zymo Research). Pooled samples were sequenced with the NGSelect Amplicon sequencing service of Eurofins Genomics.
-
bioRxiv - Microbiology 2022Quote: ... Gel extraction kit and DNA purification kit were from Zymo Research ...
-
bioRxiv - Molecular Biology 2022Quote: ... Digest of the vector (1 h, 37 C) was purified from agarose gel (Zymo Research). We ligated both with an insert:vector ratio of 1:4 using Ligase (Thermo Scientific ...
-
bioRxiv - Molecular Biology 2020Quote: ... at 37 °C for 30 minutes and was cleaned using RNA Clean & Concentrator (Zymo Research).
-
bioRxiv - Developmental Biology 2024Quote: ... DNA was hydrolysed for 6 h at 37°C using DNA degradase plus (Zymo Research). Mass spectrometry quantification was performed as previously described36 in the Babraham Institute mass spectrometry facility using three individual E18.5 wild-type and three individual E18.5 Tet3 knockout embryos.
-
bioRxiv - Biochemistry 2024Quote: ... cerevisiae strain BY4742 with endogenous Ycf1 knockout (Horizon Discovery) were transformed following the Frozen-EZ Yeast Transformation II protocol (Zymo Research). Transformed yeast strains were grown for 48 hours on YNB-His agar plates at 30 °C ...
-
bioRxiv - Cell Biology 2019Quote: RNA was isolated using a commercial kit (RNAmicro kit, Zymo Research), according to the manufacturer’s instructions ...
-
bioRxiv - Molecular Biology 2021Quote: ... Reactions were incubated overnight at 16°C and were terminated using RNA Clean & Concentrator (Zymo Research). Crosslink reversal was done by irradiating the RNA with 2.5 KJ/m2 254 nm UVC using a CL-1000 crosslinker (UVP ...
-
bioRxiv - Synthetic Biology 2020Quote: ... Plasmids were extracted from a 10 mL culture (5 OD) of sorted cells subpopulations using the Zymoprep™ Yeast Plasmid Miniprep II (Zymo Research) following manufacturer’s instructions ...
-
bioRxiv - Bioengineering 2023Quote: Wild type 4D5 and 5A12 VH and VL scFv gene fragments were purchased from Twist Bioscience and transformed into the BamHI digested pYD1 plasmid via homologous recombination (Boder and Wittrup, 1997; Chao et al., 2006) using Frozen-EZ Yeast Transformation II (Zymo Research, T2001). 4D5 scFv was transformed in a HA-VL-218-VH-FLAG orientation and 5A12 scFv as HA-VH-218-VL-FLAG ...
-
bioRxiv - Genomics 2023Quote: ... Plasmid is extracted from the bacterial culture using a 96-well mini-prep kit (Zymo kit, Zippy 96 plasmid kit). All clones are sequenced by Sanger sequencing at the site of the barcode using primer ACTTGTGTAGCGCCAAGTGC ...
-
bioRxiv - Genetics 2019Quote: ... and gel extraction kit (Zymoclean Gel DNA Recovery Kit) were from Zymo Research ...
-
bioRxiv - Biophysics 2021Quote: ... Plasmids used for nucleofections were purified by Zymo midiprep kit (Zymo D4200) and concentrations were quantified by absorption at 260 nm ...
-
bioRxiv - Synthetic Biology 2023Quote: ... coli Transformation Kit (Zymo).
-
bioRxiv - Biophysics 2023Quote: ... Plasmids were purified by Zymo midiprep kit (Zymo D4200) and all cloning was confirmed by Sanger sequencing ...
-
bioRxiv - Microbiology 2023Quote: ... coli Transformation Kit (Zymo).
-
bioRxiv - Cancer Biology 2021Quote: ... incubated at 37 °C for 30min and column purified using the RNA Clean and Concentrator-5 (Zymo) according to the manufacturer’s instructions ...
-
bioRxiv - Molecular Biology 2022Quote: ... ZymoPure Plasmid Midiprep kit and RNA Clean & Concentrator kit were purchased from Zymo Research ...
-
bioRxiv - Microbiology 2023Quote: ... RNA was isolated using a commercial kit (DirectZol RNA Miniprep kit, Zymo Research) following manufacturer instructions ...
-
bioRxiv - Immunology 2023Quote: ... the RNeasy Plus kit (specifically, the Quick RNA miniprep plus kit, Zymo, USA) was utilized and RNA was quantitated with Qubit RNA HS (High Sensitivity ...
-
bioRxiv - Molecular Biology 2023Quote: ... eluted RNA is spun out into fresh tubes and a second elution with water is performed (Zymo-I = 30μL, Zymo-II = 50μL, Zymo-IIICG = 60μL). To the eluate ...
-
bioRxiv - Molecular Biology 2023Quote: ... Proteinase K is diluted 1:19 in water and added directly to the column matrix (Zymo-I = 20μL, Zymo-II = 50μL, Zymo-IIICG = 60μL, all from Zymo Research), and then allowed to incubate on the column at 37°C for 45 min ...
-
bioRxiv - Molecular Biology 2023Quote: ... DNA and RNA were extracted using commercial kits: Quick-DNA-fungal/bacterial MiniPrep™ kit (ZymoResearch) was used for DNA and Quick-RNA-fungal/bacterial MiniPrep™ kit (Zymo Research) was used for RNA ...
-
bioRxiv - Synthetic Biology 2022Quote: ... coli using GeneJet plasmid miniprep kit (ThermoScientific) or ZymoPURE plasmid midiprep kit (Zymo Research). Sequences of all plasmids were confirmed using Sanger sequencing performed by Eurofins Genomics ...
-
bioRxiv - Microbiology 2023Quote: ... coli using GeneJet plasmid miniprep kit (ThermoScientific) or ZymoPURE plasmid midiprep kit (Zymo Research). Sequences of all plasmids were confirmed using Sanger sequencing performed by Eurofins Genomics ...
-
bioRxiv - Microbiology 2024Quote: ... The three PCR fragments were purified (Zymo DNA Clean and Concentrator kit: ‘Zymo kit’) and used in a 1:1:1 molar ratio Golden Gate assembly reaction with BsaI (NEB ...
-
bioRxiv - Genomics 2022Quote: ... followed by max speed centrifugation at 4 °C for 5 minutes and DNA purification by column purification (Zymo) prior to sample preparation for next-generation sequencing.
-
bioRxiv - Evolutionary Biology 2023Quote: ... for 30 minutes at 37 °C and products were further cleaned with RNA clean & concentrator 5 (Zymo Research) and eluted with 8-10 µl RNase free water ...
-
bioRxiv - Genomics 2023Quote: ... worms were thawed at 4°C and subsequently preserved in DNA/RNA Shield (Zymo Research, Irvine, CA, USA). Adults of T ...
-
bioRxiv - Microbiology 2021Quote: ... coli transformation kit (Zymo Research) or standard electro-transformation protocols ...
-
bioRxiv - Neuroscience 2020Quote: ... or MiniPrep Kit (R2052, Zymo Research ...
-
bioRxiv - Synthetic Biology 2020Quote: ... coli Transformation Kit (Zymo Research).
-
bioRxiv - Synthetic Biology 2021Quote: ... coli Transformation Kit from Zymo Research (Irvine ...
-
bioRxiv - Genomics 2021Quote: ... the RCC kit (Zymo Research).
-
bioRxiv - Developmental Biology 2020Quote: ... or Quick-RNA kit (Zymo). Reverse transcription was carried out by using the High-Capacity RNA-to-cDNA Kit (ThermoFisher) ...
-
bioRxiv - Developmental Biology 2023Quote: ... and RNA purification kit (Zymo). cDNA was generated using Maxima First Strand cDNA synthesis kit (Thermo Fisher Scientific) ...
-
bioRxiv - Synthetic Biology 2023Quote: ... coli Transformation Kit (Zymo Research). For each transformation ...
-
bioRxiv - Synthetic Biology 2024Quote: ... coli Transformation Kit (Zymo Research), and transformations were carried out using 50 ng of ligation product or plasmid ...
-
bioRxiv - Genetics 2023Quote: ... ZymoPure Midiprep Kit (Zymo Research) was used to prepare donor constructs for embryo injection ...