Labshake search
Citations for Zymo Research :
1 - 50 of 6054 citations for Human Lactase Like Protein LCTL ELISA Kit since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cancer Biology 2022Quote: ... was used for the estimation of global 5-hmC and 5-mC levels by ELISA using the Quest 5-hmC ELISA kit and the 5-mC DNA ELISA kit (Zymo research Inc, USA) according to the manufacturer’s instructions.
-
bioRxiv - Molecular Biology 2022Quote: ... measured with the 5mC ELISA kit (Zymo Research), to 12 % of the total human 5-methylated cytosine (5mC ...
-
bioRxiv - Genetics 2019Quote: ... Genomic DNA was used for global (5-mC DNA ELISA Kit -Zymo Research) and specific (satellite I region – BS-PCR ...
-
bioRxiv - Neuroscience 2023Quote: Genome-wide DNA methylation levels were determined using the 5-mC DNA ELISA Kit (Zymo Research, D5325) per the manufacturer’s instruction ...
-
bioRxiv - Cell Biology 2023Quote: Global DNA methylation was performed in genomic DNA using 5-mC DNA ELISA kit (Zymo Research, USA) following manufacturer’s protocol and that described in (Valdivieso et al. ...
-
bioRxiv - Plant Biology 2023Quote: ... Relative quantification of 5-methylcytosine (5-mC) over time was determined using the 5-mC DNA ELISA Kit (Zymo Research), using 100 ng of genomic DNA per sample as input ...
-
bioRxiv - Microbiology 2019Quote: ... The cells were harvested and the protein was purified using His-Spin Protein Miniprep kit (Zymo Research) according to the manufacturer’s instructions ...
-
bioRxiv - Genomics 2021Quote: RNA from human RPTECs was extracted using the Direct-zol MicroPrep Plus Kit (Zymo) following the manufacturer’s instructions ...
-
bioRxiv - Genomics 2024Quote: Total RNA was extracted from primary human PTC with the Direct-zol MicroPrep Kit (Zymo) following manufacturer’s instructions ...
-
bioRxiv - Genetics 2019Quote: Genomic DNA samples were also used for global DNA methylation analysis using the 5-mC DNA ELISA Kit (Zymo Research, Irvine, CA, USA) according to manufacturer’s protocol ...
-
bioRxiv - Genomics 2022Quote: RNA from human RPTECs was extracted with the TRIZOL and Direct-zol MicroPrep Plus Kit (Zymo) following manufacturer’s instructions ...
-
bioRxiv - Microbiology 2022Quote: ... Digestion was confirmed with methylated and unmethylated human DNA standards provided with the OneStep qMethyl kit (Zymo) as per manufacturer’s instructions ...
-
bioRxiv - Immunology 2022Quote: pAd/S1RS09cg proteins were amplified and purified using ZymoPURE II plasmid maxiprep kit (Zymo Research). For Expi293 cell transfection ...
-
bioRxiv - Microbiology 2022Quote: For human OE and OB RNA was extracted from 10mg of tissue per sample using Direct-zol RNA kit from Zymo Research (Catalog #R2052) ...
-
bioRxiv - Biochemistry 2023Quote: ... and the DNAs were purified away from protein using a DNA Clean & Concentrator kit (Zymo Research). Both 5’ ends of 1 pmole of the CRISPR leader and array fragments were then labelled with 32P ...
-
bioRxiv - Molecular Biology 2023Quote: Total RNA was extracted from human iPSC-FBs and mouse Raw 264-7 cells using the Direct-Zol RNA kit (Zymo Research) according to manufacturer instructions ...
-
bioRxiv - Genomics 2023Quote: ... 350 ng of each extracted sperm DNA and 350 ng of control human NA12878 lymphoblastoid cell line genomic DNA (Coriell Institute) were bisulfite-converted using the Zymo EZ DNA Methylation kit (Zymo Research). The loci were amplified by PCR using the following primer sets ...
-
bioRxiv - Cancer Biology 2023Quote: RNA from exponentially growing or senescent human and bowhead whale primary skin fibroblasts was isolated using the Quick-RNA MiniPrep kit (Zymo Research) according to manufacturer instructions.
-
bioRxiv - Genomics 2019Quote: ... RNA was isolated from different number of murine splenic CD3 positive T cell samples and human oocyte samples by using the Direct-zol™ RNA MiniPrep Kit (ZYMO, cat. R2050). The extracted RNA samples were dissolved into 30 µl of nuclease-free water (Qiagen ...
-
bioRxiv - Neuroscience 2022Quote: ... Then the nucleic-acid bound protein isolation was performed using buffers from the Quick-RNA Miniprep Kit (Zymo Research) and the Zymo-Spin IIICG Column (Zymo Research) ...
-
bioRxiv - Cell Biology 2023Quote: ... Endogenous RNA cross-linked to bait protein was recovered from the beads using the QuickRNA Microprep Kit (Zymo Research). Complementary DNA was synthesized using the SuperScript III First-Strand Synthesis kit (Invitrogen ...
-
bioRxiv - Genomics 2023Quote: ... DNA was captured on protein A/G agarose beads and purified using the ChIP DNA Clean & Concentrator kit (Zymo) and used for qPCR ...
-
bioRxiv - Microbiology 2022Quote: The ZymoBIOMICS human fecal reference sample (Zymo D6323) was thawed at room temperature and 100 μL was taken and centrifuged at 35g for 20 minutes to separate cells from large fecal particles ...
-
bioRxiv - Neuroscience 2019Quote: ... Methylated and unmethylated human gDNAs (Zymo Research, Irvine, CA) were bisulfite-converted using the EZ DNA Methylation-Gold kit (Zymo Research ...
-
bioRxiv - Genomics 2021Quote: ... The Human Methylated & Non-methylated DNA Set (ZYMO Research) was used to generate DNA methylation standards ...
-
bioRxiv - Microbiology 2020Quote: ... Combination of the two plasmids encoding the desired fusion proteins were transformed into Y2HGold cells using Frozen-EZ Yeast Transformation II Kit (Zymo Research). Selection for growth was carried out on selective drop-out plates lacking leucine and tryptophan (SD-Leu-Trp ...
-
bioRxiv - Plant Biology 2024Quote: ... was used to pull-down the protein/DNA complexes and DNA was purified using ChIP Clean-up and Concentrator kit (Zymo Research). Libraries were constructed using Ultra II DNA kit (NEB).
-
bioRxiv - Bioengineering 2022Quote: Yeast competent cells were transformed with polycistronic constructs containing fluorescent proteins using the Frozen-EZ yeast transformation II kit (Zymo Research, Irvine, CA) according to the manufacturer’s protocol ...
-
bioRxiv - Biochemistry 2020Quote: ... then loaded directly onto a Ni-NTA protein miniprep column (His Spin Protein Miniprep, Zymo Research). Protein was washed following the manufacturer’s instructions ...
-
bioRxiv - Immunology 2020Quote: ... whole zebrafish larvae or human biopsies using TRI Reagent (Zymo Research) or TRIzol (Invitrogen ...
-
bioRxiv - Immunology 2022Quote: Cultured or purified human cells were lysed directly in RNA lysis buffer (Zymo Research) and homogenized by pipetting ...
-
bioRxiv - Neuroscience 2020Quote: ... Protein degradation was performed by adding Proteinase K (Zymo) and Qiagen Protease (Qiagen) ...
-
bioRxiv - Immunology 2024Quote: ... Bisulfite conversion was confirmed by PCR using Universal Methylated Human DNA Standard with hMLH1 Primers (Zymo Research). Converted DNA was then applied to an Illumina Infinium MethylationEPIC850 BeadChip (865918 probes ...
-
bioRxiv - Cell Biology 2023Quote: ... ChIP-DNA was prepared using ZymoMag Protein A beads (Zymo Research). Input samples were also prepared using 10% of chromatin samples ...
-
bioRxiv - Microbiology 2022Quote: ... Gel extraction kit and DNA purification kit were from Zymo Research ...
-
bioRxiv - Cell Biology 2019Quote: RNA was isolated using a commercial kit (RNAmicro kit, Zymo Research), according to the manufacturer’s instructions ...
-
bioRxiv - Genomics 2023Quote: ... Plasmid is extracted from the bacterial culture using a 96-well mini-prep kit (Zymo kit, Zippy 96 plasmid kit). All clones are sequenced by Sanger sequencing at the site of the barcode using primer ACTTGTGTAGCGCCAAGTGC ...
-
bioRxiv - Genetics 2019Quote: ... and gel extraction kit (Zymoclean Gel DNA Recovery Kit) were from Zymo Research ...
-
bioRxiv - Bioengineering 2022Quote: ... using a commercial kit (ZymoPURE II Plasmid Maxiprep Kit; Zymo Research Corp). HEK293Ta cells (Genecopoeia ...
-
bioRxiv - Biophysics 2021Quote: ... Plasmids used for nucleofections were purified by Zymo midiprep kit (Zymo D4200) and concentrations were quantified by absorption at 260 nm ...
-
bioRxiv - Synthetic Biology 2023Quote: ... coli Transformation Kit (Zymo).
-
bioRxiv - Biophysics 2023Quote: ... Plasmids were purified by Zymo midiprep kit (Zymo D4200) and all cloning was confirmed by Sanger sequencing ...
-
bioRxiv - Microbiology 2023Quote: ... coli Transformation Kit (Zymo).
-
bioRxiv - Molecular Biology 2022Quote: ... ZymoPure Plasmid Midiprep kit and RNA Clean & Concentrator kit were purchased from Zymo Research ...
-
bioRxiv - Microbiology 2023Quote: ... RNA was isolated using a commercial kit (DirectZol RNA Miniprep kit, Zymo Research) following manufacturer instructions ...
-
bioRxiv - Biochemistry 2023Quote: ... ZymoPURE II Midiprep Kit or the ZymoPURE II Maxiprep Kit (all Zymo Research).
-
bioRxiv - Immunology 2023Quote: ... the RNeasy Plus kit (specifically, the Quick RNA miniprep plus kit, Zymo, USA) was utilized and RNA was quantitated with Qubit RNA HS (High Sensitivity ...
-
bioRxiv - Molecular Biology 2023Quote: ... DNA and RNA were extracted using commercial kits: Quick-DNA-fungal/bacterial MiniPrep™ kit (ZymoResearch) was used for DNA and Quick-RNA-fungal/bacterial MiniPrep™ kit (Zymo Research) was used for RNA ...
-
bioRxiv - Synthetic Biology 2022Quote: ... coli using GeneJet plasmid miniprep kit (ThermoScientific) or ZymoPURE plasmid midiprep kit (Zymo Research). Sequences of all plasmids were confirmed using Sanger sequencing performed by Eurofins Genomics ...
-
bioRxiv - Microbiology 2023Quote: ... coli using GeneJet plasmid miniprep kit (ThermoScientific) or ZymoPURE plasmid midiprep kit (Zymo Research). Sequences of all plasmids were confirmed using Sanger sequencing performed by Eurofins Genomics ...