Labshake search
Citations for Zymo Research :
101 - 150 of 6140 citations for Human Cytochrome P450 Family 4 Subfamily F Member 2 CYP4F2 ELISA Kit since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cell Biology 2024Quote: ... Samples were then treated with Turbo DNAse 2 to 3 times and then purified with the RNA Clean and Concentrator-5 Kit (Zymo Research Cat#: 11-325) according to the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2019Quote: ... 2 U/mL Zymolyase (Zymo research), 22 U/mL lysostaphin (MERCK) ...
-
bioRxiv - Microbiology 2021Quote: ... 2 U/mL Zymolyase (Zymo research), 22 U/mL lysostaphin (MERCK) ...
-
bioRxiv - Pharmacology and Toxicology 2020Quote: RNA was isolated from the cell culture supernatant of SARS-CoV-2-infected cells using the Quick-RNA Viral Kit (Zymo, California, USA cat no. R1035) according to the manufacturer’s instructions ...
-
bioRxiv - Immunology 2022Quote: Cultured or purified human cells were lysed directly in RNA lysis buffer (Zymo Research) and homogenized by pipetting ...
-
bioRxiv - Microbiology 2022Quote: ... 2 U/mL Zymolyase (Zymo Research Corporation), 22 U/mL lysostaphin (Sigma-Aldrich) ...
-
bioRxiv - Molecular Biology 2023Quote: ... and 2 volumes of RNA binding buffer (ZYMO) was added to each volume of RNA sample ...
-
bioRxiv - Microbiology 2020Quote: ... Most of the supernatant was removed and 750 μl of ZymoBIOMICS Lysis Solution and 19 μl of proteinase K (D3001-2-20/D3001-2-5, Zymo Research) were added to the remaining 200 μl of the samples and incubated for 30 min at +55 °C ...
-
bioRxiv - Synthetic Biology 2022Quote: ... The resulting product was purified using 4 spin columns (Zymo, DCC-25) to produce the round 1 product.
-
bioRxiv - Microbiology 2019Quote: ... 2 times volume of Viral RNA Buffer from Zymo Research (R1034-1-100 ...
-
bioRxiv - Genomics 2022Quote: ... 0.25 μL of Proteinase K (Zymo, D3001-2-5), and 2.5μL of H2O ...
-
bioRxiv - Microbiology 2023Quote: ... 2 U/mL Zymolyase (Zymo Research Corporation, CA, USA), 22 U/mL lysostaphin (Sigma-Aldrich) ...
-
bioRxiv - Microbiology 2023Quote: ... pellet resuspended with 2 ml Host Depletion Solution (Zymo) and transferred without the beads to two 1.5 ml tubes per sample ...
-
bioRxiv - Immunology 2024Quote: ... Bisulfite conversion was confirmed by PCR using Universal Methylated Human DNA Standard with hMLH1 Primers (Zymo Research). Converted DNA was then applied to an Illumina Infinium MethylationEPIC850 BeadChip (865918 probes ...
-
bioRxiv - Genomics 2023Quote: ... Libraries were eluted in DNA Elution Buffer (Zymo Research, Cat #D3004-4-10). The concentration and average size of the libraries was verified using the TapeStation DNA 5000 Assay Reagents and Screen Tapes (Agilent ...
-
bioRxiv - Genomics 2023Quote: ... The DNA pellet was eluted in elution buffer (D3004-4-10 Zymo Research) and incubated at 50°C for 10 minutes ...
-
bioRxiv - Microbiology 2022Quote: ... Gel extraction kit and DNA purification kit were from Zymo Research ...
-
bioRxiv - Neuroscience 2020Quote: ... 1 ml Proteinase K (20 mg, Zymo D3001-2-20), 9 mL water ...
-
bioRxiv - Microbiology 2023Quote: ... 2 mock community samples (Zymo Research DNA standard I D6305), 2 negative DNA extraction samples ...
-
bioRxiv - Microbiology 2023Quote: ... 2 mock community samples (Zymo Research DNA standard I D6305), 2 negative DNA extraction samples ...
-
bioRxiv - Cell Biology 2019Quote: RNA was isolated using a commercial kit (RNAmicro kit, Zymo Research), according to the manufacturer’s instructions ...
-
bioRxiv - Genomics 2023Quote: ... Plasmid is extracted from the bacterial culture using a 96-well mini-prep kit (Zymo kit, Zippy 96 plasmid kit). All clones are sequenced by Sanger sequencing at the site of the barcode using primer ACTTGTGTAGCGCCAAGTGC ...
-
bioRxiv - Synthetic Biology 2022Quote: ... 10 µL of Mag-Binding beads (Zymo Research, #D4100-2-24) was added and the sample was incubated for 3 min at room temperature ...
-
bioRxiv - Genetics 2019Quote: ... and gel extraction kit (Zymoclean Gel DNA Recovery Kit) were from Zymo Research ...
-
bioRxiv - Bioengineering 2022Quote: ... using a commercial kit (ZymoPURE II Plasmid Maxiprep Kit; Zymo Research Corp). HEK293Ta cells (Genecopoeia ...
-
bioRxiv - Biophysics 2021Quote: ... Plasmids used for nucleofections were purified by Zymo midiprep kit (Zymo D4200) and concentrations were quantified by absorption at 260 nm ...
-
bioRxiv - Synthetic Biology 2023Quote: ... coli Transformation Kit (Zymo).
-
bioRxiv - Biophysics 2023Quote: ... Plasmids were purified by Zymo midiprep kit (Zymo D4200) and all cloning was confirmed by Sanger sequencing ...
-
bioRxiv - Microbiology 2023Quote: ... coli Transformation Kit (Zymo).
-
bioRxiv - Genomics 2021Quote: ... Pellets were then resuspended in Zymo DNA elution buffer (Zymo, Cat No: D3004-4-10), and placed on the heat block at 65°C for 1 hour to completely dissolve the genomic DNA.
-
bioRxiv - Genetics 2023Quote: ... Microinjections were performed with 4-5 µg/µl (diluted in nuclease free water, Zymo Research) fas5 and GFP dsRNA on a Femtojet microinjector (Eppendorf ...
-
bioRxiv - Molecular Biology 2022Quote: ... ZymoPure Plasmid Midiprep kit and RNA Clean & Concentrator kit were purchased from Zymo Research ...
-
bioRxiv - Microbiology 2023Quote: ... RNA was isolated using a commercial kit (DirectZol RNA Miniprep kit, Zymo Research) following manufacturer instructions ...
-
bioRxiv - Biochemistry 2023Quote: ... ZymoPURE II Midiprep Kit or the ZymoPURE II Maxiprep Kit (all Zymo Research).
-
bioRxiv - Immunology 2023Quote: ... the RNeasy Plus kit (specifically, the Quick RNA miniprep plus kit, Zymo, USA) was utilized and RNA was quantitated with Qubit RNA HS (High Sensitivity ...
-
bioRxiv - Developmental Biology 2021Quote: ... 3 and 4 by lysing cells in the 6-well plate in RNA lysis buffer (Zymo) and freezing at −80 °C until extraction ...
-
bioRxiv - Molecular Biology 2023Quote: ... DNA and RNA were extracted using commercial kits: Quick-DNA-fungal/bacterial MiniPrep™ kit (ZymoResearch) was used for DNA and Quick-RNA-fungal/bacterial MiniPrep™ kit (Zymo Research) was used for RNA ...
-
bioRxiv - Synthetic Biology 2022Quote: ... coli using GeneJet plasmid miniprep kit (ThermoScientific) or ZymoPURE plasmid midiprep kit (Zymo Research). Sequences of all plasmids were confirmed using Sanger sequencing performed by Eurofins Genomics ...
-
bioRxiv - Microbiology 2023Quote: ... coli using GeneJet plasmid miniprep kit (ThermoScientific) or ZymoPURE plasmid midiprep kit (Zymo Research). Sequences of all plasmids were confirmed using Sanger sequencing performed by Eurofins Genomics ...
-
bioRxiv - Microbiology 2024Quote: ... The three PCR fragments were purified (Zymo DNA Clean and Concentrator kit: ‘Zymo kit’) and used in a 1:1:1 molar ratio Golden Gate assembly reaction with BsaI (NEB ...
-
bioRxiv - Microbiology 2021Quote: ... coli transformation kit (Zymo Research) or standard electro-transformation protocols ...
-
bioRxiv - Neuroscience 2020Quote: ... or MiniPrep Kit (R2052, Zymo Research ...
-
bioRxiv - Synthetic Biology 2020Quote: ... coli Transformation Kit (Zymo Research).
-
bioRxiv - Synthetic Biology 2021Quote: ... coli Transformation Kit from Zymo Research (Irvine ...
-
bioRxiv - Genomics 2021Quote: ... the RCC kit (Zymo Research).
-
bioRxiv - Developmental Biology 2020Quote: ... or Quick-RNA kit (Zymo). Reverse transcription was carried out by using the High-Capacity RNA-to-cDNA Kit (ThermoFisher) ...
-
bioRxiv - Synthetic Biology 2023Quote: ... coli Transformation Kit (Zymo Research). For each transformation ...
-
bioRxiv - Developmental Biology 2023Quote: ... and RNA purification kit (Zymo). cDNA was generated using Maxima First Strand cDNA synthesis kit (Thermo Fisher Scientific) ...
-
bioRxiv - Genetics 2023Quote: ... ZymoPure Midiprep Kit (Zymo Research) was used to prepare donor constructs for embryo injection ...
-
bioRxiv - Microbiology 2024Quote: ... Correct amplicons were isolated by Zymo PCR purification kit (Zymo Research). The PCR products were cloned into a PCR linearized pEcgRNA-guide plasmid to make the pEcgRNA-guide-RT plasmid using In-fusion® HD-cloning kit (Takara Bio ...