Labshake search
Citations for Zymo Research :
1 - 50 of 6348 citations for Creatinine Serum Low Sample Volume Kit 384 well Plate since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Genomics 2021Quote: Cells were FACS sorted into 384-plate wells containing 2 µl lysis buffer (Zymo M-digestion buffer also containing proteinase K) ...
-
bioRxiv - Genomics 2021Quote: ... The bisulfite conversion reaction was subsequently washed and desulfonated using reduced volumes in a 384-plate spin column (Zymo Research) essentially as described in (Luo et al. ...
-
bioRxiv - Genetics 2023Quote: RNA was extracted from each of the 384 samples in batches of 30 samples using the Direct-zol RNA Miniprep kit (Zymo Research, R2050). Batches consisted of samples from the same tissue and were processed in the order individual samples were collected ...
-
bioRxiv - Genetics 2021Quote: ... All samples were randomized into 96-well plates for RNA extraction with the Direct-zol-96 RNA Kit (Zymo Research, Irvine, CA). Libraries constructed with the Lexogen QuantSeq 3′ mRNA-Seq Library Kit FWD (Lexogen ...
-
bioRxiv - Microbiology 2024Quote: ... RNA was extracted with Direct-Zol 96 well plate kit (Zymo Research) and eluted into DNase/RNase-free water ...
-
bioRxiv - Developmental Biology 2020Quote: RNA was isolated directly from the TRIzol muscle samples using a 96 well plate extraction kit (Direct-zol™-96 RNA, Zymo Research, #R2054): after thawing to room temperature in 1,5 ml Eppendorf tubes ...
-
bioRxiv - Molecular Biology 2023Quote: ... RNA of half of the sample volume was purified using the DirectZOL Microprep kit (#2060, Zymo Research) according to the manufacturer’s instructions including the on-column DNase digestion ...
-
bioRxiv - Cell Biology 2023Quote: ... all 384 wells were pooled and purified with two DCC-5 columns (Zymo Research). Libraries were sequenced on a NovaSeq6000 system (Illumina ...
-
bioRxiv - Genomics 2023Quote: ... Each pool of heads or bodies was placed in a well of 96-well plates and total RNA was extracted using Quick-RNA 96 Kit by Zymo Research (Catalog no ...
-
bioRxiv - Cell Biology 2023Quote: ... RNA was extracted from all samples in parallel using the Direct-ZOL 96 well plate format (Zymo, #R2054), and BRB-seq libraries were prepared as previously described 20 and further detailed by the MercuriusTM Protocol (Alithea Genomics) ...
-
bioRxiv - Cell Biology 2022Quote: ... Equal volume of ethanol was added to the sample and RNA is isolated using the Direct-zol kit (Zymo research, R2050). The RNA eluted from the column was treated with TURBO DNase kit (Invitrogen ...
-
bioRxiv - Genomics 2023Quote: ... samples were placed on ice and 5 volumes of DNA Binding Buffer (Zymo) were added to each ...
-
bioRxiv - Zoology 2022Quote: ... Libraries with low 260/230 ratios (< 1.8) or low concentration were re-purified using an RNA Clean and Concentrator kit (Zymo). RNA libraries were diluted to 20 ng μL−1 and reverse transcription was performed with an iScript cDNA synthesis kit (Bio-Rad) ...
-
bioRxiv - Microbiology 2020Quote: Total RNAs were isolated from the whole blood samples from zebra finches and serum samples from woodchucks using Quick RNA Viral Kit (Zymo Research; Irvine, CA, USA). The obtained RNA samples were stored at −80°C until further requirement ...
-
bioRxiv - Genomics 2022Quote: ... separating 22 or 10 (control wells) single nuclei per well in a 96-well plate containing 2.5 μL of M-digestion buffer (Zymo, Cat. D5020-9), 0.25 μL of Proteinase K (Zymo ...
-
bioRxiv - Microbiology 2020Quote: RNA was extracted from infected cells in the 96-well plate using a ZR-96 Viral RNA Kit (Zymo Research) per manufacturer instructions ...
-
Parallelized engineering of mutational models using piggyBac transposon delivery of CRISPR librariesbioRxiv - Bioengineering 2020Quote: DNA extraction from clonal iPSC lines cultured in 96-well plates was performed using the Quick-DNA 96 Kit (Zymo Research). Briefly ...
-
bioRxiv - Genomics 2023Quote: ... RNA was extracted from each well of a 6-well plate containing ES or DE cells using 1 mL Tripure and the Direct-Zol RNA Extraction kit (Zymo Research) according to the manufacturer’s instructions ...
-
bioRxiv - Genomics 2021Quote: ... or single-nuclei (in 96-well PCR plates provided in the Zymo EZ-96 DNA Methylation-Direct™ Kit loaded with 4µL Proteinase K digestion buffer (1µL M-Digestion Buffer ...
-
bioRxiv - Neuroscience 2022Quote: ... total cellular RNA using ∼1×106 cells from one well of a six-well plate was isolated using TRIzol reagent followed by Direct-zol RNA MiniPrep Plus kit purification (Zymo Research # R2070). RNA was quantified using Qubit RNA HS Assay kit and cDNA synthesised from ∼2µg of RNA using SuperScript IV VILO Master Mix kit following gDNA removal with ezDNase ...
-
bioRxiv - Molecular Biology 2021Quote: ... Genomic DNA from individual eGFP+ cell lines was extracted from 96 well-plates using Quick-DNA Universal 96 Kit (Zymo Research, D4071) according to the manufacturer’s instructions ...
-
bioRxiv - Synthetic Biology 2023Quote: ... Cell pellets collected from 48-well plates were lysed and total RNAs were extracted using the Direct-zolTM RNA Miniprep kit (Zymo Research R2053) according to the manufacturer’s protocol ...
-
bioRxiv - Genomics 2023Quote: ... lysate from ∼1×106 cells in the well of a 6-well plate was collected in 300 µL of DNA/RNA Shield (Zymo). RNA was isolated using the Quick-RNA Miniprep Plus Kit (Zymo ...
-
bioRxiv - Microbiology 2020Quote: ... were added to media-removed cell monolayers per single well of 12 well plates followed by on-column DNA digestion and purification (Zymo Research). For RNA purification from RNP capture sample ...
-
bioRxiv - Molecular Biology 2024Quote: ... the entire volume of each sample was loaded onto a Zymogen Zymo-Spin IIN column (Zymo Research, Cat. #C1019) and spun at ≥15,000 xG for 1 min ...
-
bioRxiv - Cancer Biology 2019Quote: ... 600 ng of purified DNA were randomly distributed on a 96-well plate and processed using the EZ-96 DNA Methylation kit (Zymo Research Corp., CA, USA) following the manufacturer’s recommendations for Infinium assays ...
-
bioRxiv - Microbiology 2020Quote: ... The extracted DNA was then purified in the well-plate format using the ZR-96 Clean and Concentrator kit (Zymo research, Irvine, CA US), following manufacturer’s instructions and eluting in 6 µl of the supplied elution buffer ...
-
bioRxiv - Genomics 2020Quote: ... DNA were extracted from clonally expanded cells (from one well of the culture plate) and from Jurkat cells using Quick-DNA™ Miniprep Plus Kits (Zymo research, catalog no. D4068) according to the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2022Quote: ... the maximum volume of sample was collected and transferred to a new microcentrifuge tube with DNA/RNA lysis buffer (Zymo). Nucleic acids were purified via the Zymo Research DNA/RNA microbiome miniprep kit per the manufacturer’s instruction ...
-
bioRxiv - Cancer Biology 2021Quote: ... DNA is extracted from individual wells using Zyppy-96 Well Plasmid Miniprep Kit (Zymo Research #D4042) and sent for SANGER sequencing.
-
bioRxiv - Biochemistry 2020Quote: ... Genomic DNA of bacterial samples as well as eukaryote cells was purified using the Quick-DNA™ Miniprep Plus Kit (Zymo Research, Irvine, California, US) using the recommendations of the manufacturer.
-
bioRxiv - Molecular Biology 2023Quote: ... 60% of the bead beating volume was transferred to the Quick-RNA Miniprep Plus kit (Zymo Research), and RNA was purified using the manufacturer’s protocol for gram positive bacteria ...
-
bioRxiv - Developmental Biology 2021Quote: ... 3 and 4 by lysing cells in the 6-well plate in RNA lysis buffer (Zymo) and freezing at −80 °C until extraction ...
-
bioRxiv - Cell Biology 2020Quote: ... mixed with two volumes of 100% ethanol and purified using an RNA Clean & Concentrator-25 kit (Zymo Research) as per the manufacturer’s instructions ...
-
bioRxiv - Biochemistry 2021Quote: 96-well PCR plates with 50 µL of DH10B ‘Mix & Go Competent Cells’ (prepared using Zymo T3001) in each well were prepared beforehand so that high-throughput transfers could be done using multichannel pipettes or the Tecan Fluent ...
-
bioRxiv - Bioengineering 2023Quote: ... An equal volume of ethanol 100% was added to the sample before transferring it to a Zymo-Spin™ IIICG Column (Zymo research, C1006). The sample was centrifuged at 16000 x g for 30 s ...
-
bioRxiv - Bioengineering 2022Quote: RNA extraction performed with a Quick-RNA 96 well kit (Zymo). cDNA generation performed with a high-capacity cDNA synthesis kit using random primers and RNase inhibitor (Thermo ...
-
bioRxiv - Genomics 2023Quote: ... Plasmid is extracted from the bacterial culture using a 96-well mini-prep kit (Zymo kit, Zippy 96 plasmid kit). All clones are sequenced by Sanger sequencing at the site of the barcode using primer ACTTGTGTAGCGCCAAGTGC ...
-
bioRxiv - Microbiology 2022Quote: ... and plasmid was isolated using 96-well yeast miniprep kits (Zymo D2005) according to manufacturer instructions ...
-
bioRxiv - Developmental Biology 2022Quote: ... NPCs were lysed in 1ml Trizol(Qiagen)/well and RNA was isolated employing RNA Clean & Concentrator kit (Zymo Research) including digestion of remaining genomic DNA according to producer’s guidelines ...
-
bioRxiv - Developmental Biology 2023Quote: ... NPCs were lysed in 1ml Trizol(Qiagen)/well and RNA was isolated employing RNA Clean & Concentrator kit (Zymo Research) including digestion of remaining genomic DNA according to producer’s guidelines ...
-
bioRxiv - Genetics 2023Quote: ... and cloning as well as DNA extraction kits were sourced from Zymo. The A ...
-
bioRxiv - Molecular Biology 2023Quote: ... and 2 volumes of RNA binding buffer (ZYMO) was added to each volume of RNA sample ...
-
bioRxiv - Systems Biology 2022Quote: ... Samples were cleaned with DNA Clean and Concentrator kit (Zymo) and sequenced on an Illumina MiSeq.
-
bioRxiv - Bioengineering 2023Quote: ... samples were purified using DNA Clean & Concentrator-25 kit (Zymo). The barcoded FXN region was further recovered and the adaptor sequence was added by performing PCR using primers of 5’-ACGCTCTTCCGATCTTGTTCCAGATTACGCTTGAG-3’ and 5’-TGTGCTCTTCCGATCTTGTAATCCAGAGGTTGATTATCG-3’ at 10 cycles of 98°C for 10s ...
-
bioRxiv - Biophysics 2022Quote: ... Cells were scraped from each phenotyping plate after defined growth periods and genomic DNA was extracted from each screening plate with Yeastar Genomic DNA kit (Zymo) and amplified using emulsion PCR (EURx Micellula DNA Emulsion & Purification (ePCR ...
-
bioRxiv - Microbiology 2021Quote: ... Equal volume of 100% EtOH was mixed with the TRIzol homogenate and processed using Direct-Zol RNA MiniPrep Kit (Zymo) to extract viral RNA ...
-
bioRxiv - Genetics 2020Quote: ... DNA was then concentrated to a volume of 50 µL using the DNA Clean & Concentrator kit (Cat. No. D4013) from Zymo Research (Irvine ...
-
bioRxiv - Microbiology 2022Quote: 74μL of ultrapure water was added to the remaining sample (to make up to 100μL total volume) and each reaction was then purified using the Zymo Genomic Clean and Concentrate kit (Zymo D4011). The DNA was eluted with 10mM Tris buffer heated to 63°C and incubated for a few minutes ...
-
bioRxiv - Neuroscience 2023Quote: ... A small volume (∼10µl) of the dissociated cells was used for DNA isolation by using Quick-DNA Microprep Kit (Zymo research). The DNA was amplified by PCR and sequenced via Sanger Sequencing ...