Labshake search
Citations for Zymo Research :
101 - 150 of 6156 citations for Cow WAP kazal immunoglobulin kunitz and NTR domain containing protein 2 WFIKKN2 ELISA Kit since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cancer Biology 2022Quote: ... The outer PCR products amplified using primer #1 and #2 were purified and concentrated using the DNA Clean and Concentrator 5 kit (Zymo Research, Orange, CA) and eluted in 20ul of TE buffer ...
-
bioRxiv - Genomics 2021Quote: ... containing 600 µL of 2x DNA/RNA shield (Zymo Research). gentleMACS M tubes were then placed on the gentleMACS Dissociator (Miltenyi Biotec ...
-
bioRxiv - Physiology 2023Quote: ... Complementary DNA (cDNA) was synthesized from 1 to 2 μg of RNA using High-Capacity RNA-to-cDNA™ Kit (Zymo Research, Irvine, CA). Quantitative real-time polymerase chain reaction (qPCR ...
-
bioRxiv - Cell Biology 2024Quote: ... Samples were then treated with Turbo DNAse 2 to 3 times and then purified with the RNA Clean and Concentrator-5 Kit (Zymo Research Cat#: 11-325) according to the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2019Quote: ... 2 U/mL Zymolyase (Zymo research), 22 U/mL lysostaphin (MERCK) ...
-
bioRxiv - Microbiology 2021Quote: ... 2 U/mL Zymolyase (Zymo research), 22 U/mL lysostaphin (MERCK) ...
-
bioRxiv - Pharmacology and Toxicology 2020Quote: RNA was isolated from the cell culture supernatant of SARS-CoV-2-infected cells using the Quick-RNA Viral Kit (Zymo, California, USA cat no. R1035) according to the manufacturer’s instructions ...
-
bioRxiv - Systems Biology 2023Quote: ... We also included seven negative controls containing only Shield™ (Zymo Research) in the extractions ...
-
bioRxiv - Microbiology 2022Quote: ... 2 U/mL Zymolyase (Zymo Research Corporation), 22 U/mL lysostaphin (Sigma-Aldrich) ...
-
bioRxiv - Neuroscience 2020Quote: ... Protein degradation was performed by adding Proteinase K (Zymo) and Qiagen Protease (Qiagen) ...
-
bioRxiv - Evolutionary Biology 2019Quote: ... Tetrads were re-suspended in water containing zymolyase (Zymo research, 0.025 u/μl), incubated at 37°C for 45 sec ...
-
bioRxiv - Molecular Biology 2023Quote: ... and 2 volumes of RNA binding buffer (ZYMO) was added to each volume of RNA sample ...
-
bioRxiv - Microbiology 2020Quote: ... Most of the supernatant was removed and 750 μl of ZymoBIOMICS Lysis Solution and 19 μl of proteinase K (D3001-2-20/D3001-2-5, Zymo Research) were added to the remaining 200 μl of the samples and incubated for 30 min at +55 °C ...
-
bioRxiv - Microbiology 2020Quote: ... 0.5% Triton X-100 in PBS) containing 5–10 U DNase I (Zymo Research) for 30 min at room temperature ...
-
bioRxiv - Microbiology 2019Quote: ... 2 times volume of Viral RNA Buffer from Zymo Research (R1034-1-100 ...
-
bioRxiv - Genomics 2022Quote: ... 0.25 μL of Proteinase K (Zymo, D3001-2-5), and 2.5μL of H2O ...
-
bioRxiv - Microbiology 2023Quote: ... 2 U/mL Zymolyase (Zymo Research Corporation, CA, USA), 22 U/mL lysostaphin (Sigma-Aldrich) ...
-
bioRxiv - Microbiology 2023Quote: ... pellet resuspended with 2 ml Host Depletion Solution (Zymo) and transferred without the beads to two 1.5 ml tubes per sample ...
-
bioRxiv - Developmental Biology 2021Quote: ... and submerged in digest solution containing 1X Digest Buffer (Zymo Research, Cat#: D3050-1-5) and supplemented with 1mg/mL Proteinase K (Zymo Research ...
-
bioRxiv - Microbiology 2021Quote: ... 140µl of supernatant was collected in tubes containing 140µl of DNA/RNA Shield (Zymo Research) for SARS-CoV-2 inactivation ...
-
bioRxiv - Cell Biology 2023Quote: ... ChIP-DNA was prepared using ZymoMag Protein A beads (Zymo Research). Input samples were also prepared using 10% of chromatin samples ...
-
bioRxiv - Microbiology 2022Quote: ... Gel extraction kit and DNA purification kit were from Zymo Research ...
-
bioRxiv - Neuroscience 2020Quote: ... 1 ml Proteinase K (20 mg, Zymo D3001-2-20), 9 mL water ...
-
bioRxiv - Microbiology 2023Quote: ... 2 mock community samples (Zymo Research DNA standard I D6305), 2 negative DNA extraction samples ...
-
bioRxiv - Microbiology 2023Quote: ... 2 mock community samples (Zymo Research DNA standard I D6305), 2 negative DNA extraction samples ...
-
bioRxiv - Microbiology 2022Quote: ... we included serial dilutions of a mock community containing both bacterial and fungal taxa (i.e., Zymo Research ZymoBIOMICS Mock Community Standard I ...
-
bioRxiv - Molecular Biology 2020Quote: ... The mixture of the RNA containing supernantant and 1 volume of isopropanol was filtered by Zymo-Spin™ ICG Column (Zymo) ...
-
bioRxiv - Immunology 2022Quote: ... Sixty to one hundred twenty milligrams were transferred to lysis tubes containing bashing beads (Zymo Research) and 1 mL TRIzol (Thermo Fisher) ...
-
bioRxiv - Microbiology 2023Quote: ... or placed in 1.5ml cryovials containing 750 ul Xpedition™ RNA/DNA Shield (Zymo Research Products) and stored at ambient temperature before transportation to the laboratory where they were subsequently stored at -20°C until DNA extraction22 ...
-
bioRxiv - Cell Biology 2019Quote: RNA was isolated using a commercial kit (RNAmicro kit, Zymo Research), according to the manufacturer’s instructions ...
-
bioRxiv - Biochemistry 2020Quote: ... stool samples were collected at endpoint and stored in Eppendorf tubes containing DNA/RNA shield (Zymo Research). Samples were sent in dry ice to CosmoID for 16S sequencing and inference of microbiome abundance.
-
bioRxiv - Bioengineering 2022Quote: ... Cryofilm pieces containing the tissues were submerged in digest solution consisting of 1X Digestion Buffer (Zymo Research) and 1 mg/ml Proteinase K (Zymo Research ...
-
bioRxiv - Genomics 2023Quote: ... Samples and tissues were collected into cryovials containing 0.5 mL of DNA/RNA Shield (Zymo R1200 125) or viral transport media (VTM) ...
-
bioRxiv - Molecular Biology 2023Quote: ... Swabs were then placed in 1mL Matrix 2D Screw Tubes containing 400uL of DNA/RNA Shield (Zymo). The tip of the swab was broken off so that only the swab tip was stored in the Matrix 2D Screw Tube ...
-
bioRxiv - Immunology 2024Quote: ... lung and nasal turbinate tissues were collected in an Omni Bead Ruptor tube containing Tri reagent (Zymo). Subsequently ...
-
bioRxiv - Genomics 2023Quote: ... Plasmid is extracted from the bacterial culture using a 96-well mini-prep kit (Zymo kit, Zippy 96 plasmid kit). All clones are sequenced by Sanger sequencing at the site of the barcode using primer ACTTGTGTAGCGCCAAGTGC ...
-
bioRxiv - Synthetic Biology 2022Quote: ... 10 µL of Mag-Binding beads (Zymo Research, #D4100-2-24) was added and the sample was incubated for 3 min at room temperature ...
-
bioRxiv - Genetics 2019Quote: ... and gel extraction kit (Zymoclean Gel DNA Recovery Kit) were from Zymo Research ...
-
bioRxiv - Bioengineering 2022Quote: ... using a commercial kit (ZymoPURE II Plasmid Maxiprep Kit; Zymo Research Corp). HEK293Ta cells (Genecopoeia ...
-
bioRxiv - Biophysics 2021Quote: ... Plasmids used for nucleofections were purified by Zymo midiprep kit (Zymo D4200) and concentrations were quantified by absorption at 260 nm ...
-
bioRxiv - Synthetic Biology 2023Quote: ... coli Transformation Kit (Zymo).
-
bioRxiv - Biophysics 2023Quote: ... Plasmids were purified by Zymo midiprep kit (Zymo D4200) and all cloning was confirmed by Sanger sequencing ...
-
bioRxiv - Microbiology 2023Quote: ... coli Transformation Kit (Zymo).
-
bioRxiv - Molecular Biology 2022Quote: ... ZymoPure Plasmid Midiprep kit and RNA Clean & Concentrator kit were purchased from Zymo Research ...
-
bioRxiv - Microbiology 2023Quote: ... RNA was isolated using a commercial kit (DirectZol RNA Miniprep kit, Zymo Research) following manufacturer instructions ...
-
bioRxiv - Biochemistry 2023Quote: ... ZymoPURE II Midiprep Kit or the ZymoPURE II Maxiprep Kit (all Zymo Research).
-
bioRxiv - Immunology 2023Quote: ... the RNeasy Plus kit (specifically, the Quick RNA miniprep plus kit, Zymo, USA) was utilized and RNA was quantitated with Qubit RNA HS (High Sensitivity ...
-
bioRxiv - Microbiology 2019Quote: ... 0.5% [w/v] SDS) and transferred into a chilled tube containing zirconia beads (ZYMO Research, Irvine, CA, USA). Primary extractions of RNA were performed with acidic phenol:chloroform (5:1 ...
-
bioRxiv - Molecular Biology 2023Quote: ... DNA and RNA were extracted using commercial kits: Quick-DNA-fungal/bacterial MiniPrep™ kit (ZymoResearch) was used for DNA and Quick-RNA-fungal/bacterial MiniPrep™ kit (Zymo Research) was used for RNA ...
-
bioRxiv - Synthetic Biology 2022Quote: ... coli using GeneJet plasmid miniprep kit (ThermoScientific) or ZymoPURE plasmid midiprep kit (Zymo Research). Sequences of all plasmids were confirmed using Sanger sequencing performed by Eurofins Genomics ...