Labshake search
Citations for Zymo Research :
1 - 50 of 6059 citations for Cow Hepatoma Derived Growth Factor HDGF ELISA Kit since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cell Biology 2023Quote: ... After 3 h of growth cells were arrested with 25 μM α-factor (Zymo Research) for 3 h ...
-
bioRxiv - Cancer Biology 2022Quote: ... was used for the estimation of global 5-hmC and 5-mC levels by ELISA using the Quest 5-hmC ELISA kit and the 5-mC DNA ELISA kit (Zymo research Inc, USA) according to the manufacturer’s instructions.
-
bioRxiv - Molecular Biology 2022Quote: ... measured with the 5mC ELISA kit (Zymo Research), to 12 % of the total human 5-methylated cytosine (5mC ...
-
bioRxiv - Cell Biology 2023Quote: ... α-factor (Zymo Research) treatment was applied at a concentration of 30 ng/ml (for bar1Δ background strains ...
-
bioRxiv - Molecular Biology 2023Quote: ... α-factor (ZYMO RESEARCH) was added to the cultures at a final concentration of 20 nM ...
-
bioRxiv - Molecular Biology 2024Quote: ... α-factor (ZYMO RESEARCH) was added to the cultures at a final concentration of 20 nM ...
-
bioRxiv - Genetics 2019Quote: ... Genomic DNA was used for global (5-mC DNA ELISA Kit -Zymo Research) and specific (satellite I region – BS-PCR ...
-
bioRxiv - Developmental Biology 2020Quote: Total RNA from FACS-sorted hPSC-derived cardiomyocytes was isolated using the Quick-RNA microprep kit (Zymo Research) and submitted to the NYU Genomics Facility for QC ...
-
bioRxiv - Microbiology 2020Quote: RNA was extracted from organoid-derived monolayer (ODM) and organoid cultures using Direct-zol RNA Microprep kit (Zymo) followed by on-column DNase I treatment following manufacturer’s protocol ...
-
bioRxiv - Bioengineering 2023Quote: Genomic DNA was extracted from single-cell derived clones with the Quick-DNA Miniprep Plus Kit (Zymo Research). The DNA concentration was measured using a NanoDrop ...
-
bioRxiv - Immunology 2021Quote: The RNA of tissue-derived or cultured BM-eos was isolated using Directzol RNA MicroPrep kit (R2062 Zymo Research) according to the manufacturer’s instructions ...
-
bioRxiv - Cancer Biology 2020Quote: DNA from single-cell-derived bacterial or cell colonies was extracted with a Quick-DNA Miniprep Kit (Zymo #D3025). Combinatorial primer sets designed to recognize the 5′ and 3′ knock-in boundaries were used with the following PCR cycling conditions ...
-
bioRxiv - Cancer Biology 2020Quote: ... DNA was purified from each LCM-derived lesion using the Quick-DNA/RNA Microprep Plus Kit from Zymo (D7005). The evolving barcode library was generated as previously described (Kalhor et al. ...
-
bioRxiv - Cell Biology 2021Quote: ... Media components were from Sunrise Science Products and a-factor was from Zymo Research ...
-
bioRxiv - Cancer Biology 2022Quote: Total RNA from TAM and ML-DS patient-derived samples were isolated using the Quick-RNA Microprep Kit (Zymo Research). The MicroMACS mRNA isolation kit (Miltenyi Biotech ...
-
bioRxiv - Genetics 2023Quote: ... coli-derived Ydj1-CXXX plasmid library was transformed into yWS304 (ydj1Δ) via Frozen-EZ Yeast transformation II Kit by Zymo Research (Irvine ...
-
bioRxiv - Neuroscience 2023Quote: Genome-wide DNA methylation levels were determined using the 5-mC DNA ELISA Kit (Zymo Research, D5325) per the manufacturer’s instruction ...
-
bioRxiv - Cell Biology 2023Quote: Global DNA methylation was performed in genomic DNA using 5-mC DNA ELISA kit (Zymo Research, USA) following manufacturer’s protocol and that described in (Valdivieso et al. ...
-
bioRxiv - Pharmacology and Toxicology 2023Quote: Total RNA was isolated from polarized murine bone marrow-derived macrophages using the Quick-RNA™ MiniPrep Kit (Zymo Research, Irvine, CA, USA). RNA quantity and quality was verified by two methods ...
-
bioRxiv - Immunology 2022Quote: ... Successful clones were used to inoculate liquid culture for overnight growth followed by plasmid minipreps (Zyppy miniprep kit, Zymo). Pooled libraries were subjected to maxipreps (Nucleobond Maxiprep EF kit ...
-
bioRxiv - Biophysics 2022Quote: ... Cells were scraped from each phenotyping plate after defined growth periods and genomic DNA was extracted from each screening plate with Yeastar Genomic DNA kit (Zymo) and amplified using emulsion PCR (EURx Micellula DNA Emulsion & Purification (ePCR ...
-
bioRxiv - Microbiology 2023Quote: RNA was isolated from mid-log phase protists grown at normal growth temperature or 12°C using the Direct-zol RNA Miniprep kit (Zymo). RNA libraries were generated using the KAPA Stranded mRNA Sequencing Kit (Roche) ...
-
bioRxiv - Plant Biology 2023Quote: ... Relative quantification of 5-methylcytosine (5-mC) over time was determined using the 5-mC DNA ELISA Kit (Zymo Research), using 100 ng of genomic DNA per sample as input ...
-
bioRxiv - Evolutionary Biology 2023Quote: ... Gibson’s reaction-derived plasmid product was used to transform JM109 cells (Zymo Research), and colonies were individually grown overnight for minipreps with Zyppy Plasmid Miniprep Kit (Zymo Research) ...
-
bioRxiv - Plant Biology 2023Quote: ... 10 mM CaCl2 or both chemicals for 16 h (see Plant materials, growth and stress assays) using the ZR Plant RNA MiniPrep Kit (Zymo Research). RNA sequencing was performed at The Mantoux Institute for Bioinformatics of the Nancy and Stephen Grand Israel National Center for Personalized Medicine ...
-
bioRxiv - Synthetic Biology 2020Quote: ... and 80 uM of “a-factor” (Zymo Research catalog # Y1004-500) was added to inhibit the growth of switched α cells before HO induction ...
-
bioRxiv - Biophysics 2021Quote: ... after incubation for 120 minutes with 10 µM α-factor pheromone (Zymo-Research Corp ...
-
bioRxiv - Genomics 2022Quote: ... were synchronized in either G1 with alpha-factor (Zymo Research, CAT. Y1001), or in late anaphase ...
-
bioRxiv - Genetics 2019Quote: Genomic DNA samples were also used for global DNA methylation analysis using the 5-mC DNA ELISA Kit (Zymo Research, Irvine, CA, USA) according to manufacturer’s protocol ...
-
bioRxiv - Genomics 2022Quote: DNA derived from all samples was treated with bisulfite using EZ DNA Methylation-Gold (Zymo Research), according to the manufacturer’s instructions ...
-
bioRxiv - Biophysics 2020Quote: ... as follows: A purified α-factor pheromone suspension (Y1001, Zymo Research, Irvine, CA) was diluted to a working concentration of 10 μM in 100 mM KCl to achieve and maintain saturation binding of ligand to receptors present within sample cell membranes59–60 ...
-
bioRxiv - Genomics 2021Quote: DNA derived from all samples was treated with bisulfite using EZ DNA Methylation-Gold™ (Zymo Research), according to the manufacturer’s instructions ...
-
bioRxiv - Genetics 2022Quote: ... and a disc of sterile filter paper saturated with 10μL of 200μM α-factor (Zymo Research) was gently embedded in the center ...
-
bioRxiv - Genetics 2022Quote: ... cells were synchronized in G1 phase by addition of 4 µg/mL α-factor (Zymo research, mating hormone peptide) for 2 h ...
-
bioRxiv - Genetics 2023Quote: ... strains (OD600= 0.3 - 0.5; ∼107 cells/ml) in YPD supplemented with 0.1 μg/ml a- factor (Zymo Research, Y1004) for 3 h 30 min (yDT67 ...
-
bioRxiv - Genomics 2023Quote: The PCR products were pooled per growth media condition and purified with DNA Clean & Concentrator (Zymo Research). The second PCR was performed using PrimeSTAR GXL polymerase (Takara ...
-
bioRxiv - Genomics 2022Quote: Total RNA was isolated from LV apical core tissue and from beating human iPS cell derived cardiomyocytes using Quick-RNA Miniprep Plus (Zymo Research, Irvine, CA, USA). The qRT-PCR was performed using SYBR mix (Thermofisher ...
-
bioRxiv - Cell Biology 2024Quote: ... Successful colonies were then inoculated to growth medium (Luria Broth) containing Ampicillin (AppliChem, no. A0839) and Chloramphenicol (Brunschwig, no. ACR22792-0250) for miniprep (Zymo, no. D4015) and validation ...
-
bioRxiv - Microbiology 2022Quote: ... Gel extraction kit and DNA purification kit were from Zymo Research ...
-
bioRxiv - Cell Biology 2019Quote: RNA was isolated using a commercial kit (RNAmicro kit, Zymo Research), according to the manufacturer’s instructions ...
-
bioRxiv - Genomics 2023Quote: ... Plasmid is extracted from the bacterial culture using a 96-well mini-prep kit (Zymo kit, Zippy 96 plasmid kit). All clones are sequenced by Sanger sequencing at the site of the barcode using primer ACTTGTGTAGCGCCAAGTGC ...
-
bioRxiv - Genetics 2019Quote: ... and gel extraction kit (Zymoclean Gel DNA Recovery Kit) were from Zymo Research ...
-
bioRxiv - Bioengineering 2022Quote: ... using a commercial kit (ZymoPURE II Plasmid Maxiprep Kit; Zymo Research Corp). HEK293Ta cells (Genecopoeia ...
-
bioRxiv - Biophysics 2021Quote: ... Plasmids used for nucleofections were purified by Zymo midiprep kit (Zymo D4200) and concentrations were quantified by absorption at 260 nm ...
-
bioRxiv - Synthetic Biology 2023Quote: ... coli Transformation Kit (Zymo).
-
bioRxiv - Biophysics 2023Quote: ... Plasmids were purified by Zymo midiprep kit (Zymo D4200) and all cloning was confirmed by Sanger sequencing ...
-
bioRxiv - Microbiology 2023Quote: ... coli Transformation Kit (Zymo).
-
bioRxiv - Molecular Biology 2022Quote: ... ZymoPure Plasmid Midiprep kit and RNA Clean & Concentrator kit were purchased from Zymo Research ...
-
bioRxiv - Microbiology 2023Quote: ... RNA was isolated using a commercial kit (DirectZol RNA Miniprep kit, Zymo Research) following manufacturer instructions ...
-
bioRxiv - Biochemistry 2023Quote: ... ZymoPURE II Midiprep Kit or the ZymoPURE II Maxiprep Kit (all Zymo Research).