Labshake search
Citations for Zymo Research :
601 - 650 of 6397 citations for Cortisone Chemiluminescent ELISA Kit 5 Plate since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Neuroscience 2023Quote: ... after which DNA was purified by silica column (Zymo DCC-5) with final volume of 20uL using elution buffer ...
-
bioRxiv - Microbiology 2023Quote: ... and shaken vigorously for 5 min using a Genie Disruptor (Zymo). This suspension was diluted in LB ...
-
bioRxiv - Molecular Biology 2023Quote: ... and purified with RNA Clean and Concentrator-5 (Zymo Research, #R1013) according to the manufacturer’s instructions that separately recover small and large RNA fractions ...
-
bioRxiv - Microbiology 2023Quote: ... DNA libraries were extracted with DNA Clean and Concentrator-5 (Zymo), and optimal PCR cycle number was determined via quantitative PCR31,36 ...
-
bioRxiv - Microbiology 2023Quote: ... DNA libraries were extracted with DNA Clean and Concentrator-5 (Zymo) and eluted with 21 μL water.
-
bioRxiv - Molecular Biology 2023Quote: ... RNA recovery was performed using RNA Clean & Concentrator-5 (Zymo Research) according to manufacturer instructions ...
-
bioRxiv - Cell Biology 2023Quote: ... The quantification of global 5-methylcytosine levels was performed by Zymo Research (US ...
-
bioRxiv - Genomics 2023Quote: ... Purification was then done with DNA Clean & Concentrator-5 (ZYMO D4013) according to the manufacturer’s guidelines ...
-
bioRxiv - Molecular Biology 2023Quote: ... Samples were column-purified using RNA Clean & Concentrator-5 (Zymo Research), and the concentration was determined using the DeNovix RNA Assay (DeNovix) ...
-
Emergence of RNA-guided transcription factors via domestication of transposon-encoded TnpB nucleasesbioRxiv - Genetics 2023Quote: ... Samples were column-purified using RNA Clean & Concentrator-5 (Zymo Research), and the concentration was determined using the DeNovix RNA Assay (DeNovix) ...
-
bioRxiv - Microbiology 2023Quote: ... Samples were re-purified using RNA Clean & Concentrator-5 (Zymo Research) to remove small RNAs.
-
bioRxiv - Microbiology 2022Quote: ... Gel extraction kit and DNA purification kit were from Zymo Research ...
-
bioRxiv - Genomics 2021Quote: ... gDNA from two plates were pooled and concentrated using DNA Clean & Concentrator-25 (D4033, Zymo) to obtain high enough input and concentration ...
-
bioRxiv - Molecular Biology 2021Quote: ... and RNA was selectively recovered with RNA Clean and Concentrator-5 (Zymo) according to the manufacturer’s protocol ...
-
bioRxiv - Genomics 2020Quote: ... and purified using RNA Clean and Concentrator-5 spin columns (Zymo #R1013) according to manufactures instructions.
-
bioRxiv - Genomics 2020Quote: ... 2.5 μl of 10 mM 5-Methylcytosine dNTP mix (Zymo Research, D1030), and incubated at 15 °C for one hour ...
-
bioRxiv - Immunology 2019Quote: ... The PCR product was purified using DNA Clean &ConcentratorTM-5 (Zymo, D4013), eluted in nuclease-free (NF ...
-
bioRxiv - Cancer Biology 2020Quote: ... PCR products were purified using DNA Clean and Concentrator-5 columns (Zymo) and subsequently analyzed by Sanger sequencing.
-
Insights into the secondary structural ensembles of the full SARS-CoV-2 RNA genome in infected cellsbioRxiv - Biochemistry 2021Quote: ... The PCR product was purified by DNA Clean and Concentrator −5 (Zymo) following manufacturer’s instructions ...
-
bioRxiv - Microbiology 2020Quote: ... DNA was purified with DNA Clean & Concentrator™-5 (Zymo Research, D4004). One nanogram of eluted DNA was used as input for library construction with a TruePrep DNA Library Prep Kit V2 for Illumina (Vazyme ...
-
bioRxiv - Microbiology 2020Quote: ... and purified using RNA Clean & Concentrator-5 (Zymo research, Irvine, CA, USA).
-
bioRxiv - Genetics 2020Quote: ... The tagmented DNA was purified with DNA Clean & Concentrator-5 (Zymo Research) and eluted in 30 μl elution buffer ...
-
bioRxiv - Microbiology 2021Quote: ... The RNA was purified using RNA Clean and Concentrator™-5 (Zymo). Between 1-2 μg RNA was denatured at 95°C for 1 min ...
-
bioRxiv - Genomics 2022Quote: ... and purified over an RNA Clean and Concentrator -5 column (Zymo Research) after each DNase treatment ...
-
bioRxiv - Microbiology 2022Quote: ... Golden-gate reactions were purified with DNA Clean & Concentrator-5 (Zymo Research) and electroporated into DH10b (NEB ...
-
bioRxiv - Cancer Biology 2020Quote: ... The RNA was column-purified (RNA Clean & Concentrator-5, Zymo, Cat# R1015) and eluted in 8 μl molecular biology grade ...
-
bioRxiv - Biochemistry 2020Quote: ... The crude RNAs were purified using RNA Clean & Concentrator-5 (Zymo Research). Transcripts quality was checked on 15% acrylamide/7 M urea gels ...
-
bioRxiv - Microbiology 2020Quote: ... The reaction was terminated by adding RNA Clean & ConcentratorTM-5 (Zymo Research). It is noteworthy that SuperRNaseIn targets RNases A ...
-
bioRxiv - Microbiology 2021Quote: ... the transcript products were purified using the RNA Clean & ConcentratorTM-5 (Zymo Research ...
-
bioRxiv - Developmental Biology 2021Quote: ... and purified using RNA Clean and Concentrator-5 spin columns (Zymo #R1013) according to the manufacturer’s instructions.
-
bioRxiv - Microbiology 2023Quote: ... The PCR product was purified using DNA Clean & Concentrator-5 (Zymo Research), sequentially digested with FastDigest SfiI and FastDigest DpnI (Thermo Scientific) ...
-
bioRxiv - Microbiology 2023Quote: ... and the cloning insert purified by DNA Clean & Concentrator-5 (Zymo Research). Vector pSBbi-bla ...
-
bioRxiv - Genomics 2023Quote: PCR products were purified using DNA Clean & Concentrator™-5 columns (Zymo Research Europe GmbH ...
-
bioRxiv - Plant Biology 2023Quote: ... and cleaned up using the RNA Clean and ConcentratorTM-5 (Zymo Research). PolyA mRNA was isolated using the NEBNext Poly(A ...
-
bioRxiv - Genomics 2024Quote: ... Fragmented DNA was cleaned up using DNA Clean & Concentrator-5 (Zymo Research). To visualize the fragmentation ...
-
bioRxiv - Cell Biology 2019Quote: RNA was isolated using a commercial kit (RNAmicro kit, Zymo Research), according to the manufacturer’s instructions ...
-
bioRxiv - Developmental Biology 2021Quote: ... 3 and 4 by lysing cells in the 6-well plate in RNA lysis buffer (Zymo) and freezing at −80 °C until extraction ...
-
bioRxiv - Genomics 2023Quote: ... Plasmid is extracted from the bacterial culture using a 96-well mini-prep kit (Zymo kit, Zippy 96 plasmid kit). All clones are sequenced by Sanger sequencing at the site of the barcode using primer ACTTGTGTAGCGCCAAGTGC ...
-
bioRxiv - Genetics 2019Quote: ... and gel extraction kit (Zymoclean Gel DNA Recovery Kit) were from Zymo Research ...
-
bioRxiv - Bioengineering 2022Quote: ... using a commercial kit (ZymoPURE II Plasmid Maxiprep Kit; Zymo Research Corp). HEK293Ta cells (Genecopoeia ...
-
bioRxiv - Molecular Biology 2021Quote: ... and RNA was selectively recovered with RNA clean and concentrator-5 (Zymo Research). RNA fragments were then 5’ phosphorylated with T4 polynucleotide kinase in T4 PNK buffer ...
-
bioRxiv - Developmental Biology 2021Quote: ... and supplemented with 1mg/mL Proteinase K (Zymo Research, Cat#: D3001-2-5) for 1 hour at 55°C ...
-
bioRxiv - Cell Biology 2019Quote: ... Cells were resuspended in 50 μL KMS with 5 U Zymolyase (Zymo E1004) for 20 min at 37 °C ...
-
bioRxiv - Molecular Biology 2019Quote: ... 10 ul M-Digestion Buffer and 1ml Proteinase K (Zymo D3001-2-5) were added and incubated for 20 minutes at 50°C ...
-
bioRxiv - Genetics 2021Quote: ... RNA samples were purified with an RNA Clean & Concentrator-5 (Zymo Research, R1015), and cDNA generated as described ...
-
bioRxiv - Microbiology 2020Quote: ... RNA was cleaned using the Zymo Clean and Concentrate 5 column (Zymo Research) and eluted in 2x 20 μL (final 40 μL) ...
-
bioRxiv - Genomics 2021Quote: ... Reactions were pooled and purified by DNA Clean and Concentrator 5 (Zymo Research). pLCv2-opti-stuffer-mCherry was digested as described 41 ...
-
bioRxiv - Developmental Biology 2022Quote: Linearized plasmid DNA was cleaned using DNA Clean & concentrator-5 (Zymo Research #D4014). In situ hybridization was completed according to a standard protocol (Cunningham and Monk ...
-
bioRxiv - Microbiology 2022Quote: ... The DMS-modified RNA was purified using RNA Clean and ConcentratorTM-5 (Zymo) and eluted in 10µl water.
-
bioRxiv - Genetics 2022Quote: ... followed by another round of clean up (Zymo RNA Clean and Concentrator 5). The final sequence of the spike-in mRNA is ...