Labshake search
Citations for Zymo Research :
351 - 400 of 1044 citations for 7H Cyclopenta c pyridin 7 one 5 6 dihydro 3 methyl 9CI since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Genomics 2024Quote: ... Fragmented DNA was cleaned up using DNA Clean & Concentrator-5 (Zymo Research). To visualize the fragmentation ...
-
bioRxiv - Systems Biology 2024Quote: ... or the DNA Clean & Concentrator-5 kit (Zymo Research, Irvine, CA, D4013). Reactions were purified with 1.8X Mag-Bind TotalPure NGS magnetic beads (Omega ...
-
bioRxiv - Plant Biology 2024Quote: ... then purified with the RNA clean and concentrator 5 kit (ZYMO; R1016).
-
bioRxiv - Molecular Biology 2023Quote: ... DNA was cleaned by DNA clean and concentrator-5 kit (Zymo, D4014) and sheared by Diagenode Biorupter Pico (EZ mode ...
-
bioRxiv - Genetics 2024Quote: ... PCR amplicons were purified using DNA Clean & Concentrator-5 kit (Zymo Research) following the manufacturer’s recommendations ...
-
bioRxiv - Synthetic Biology 2022Quote: ... at a ratio of 1:3 (DNA : Zymo Shield / 20 µl DNA:60 µl Zymo Shield). O volume of 5µl of the PCR product was loaded on a gel for confirmation of the reaction ...
-
bioRxiv - Synthetic Biology 2022Quote: ... at a ratio of 1:3 (DNA : Zymo Shield / 20 µl DNA:60 µl Zymo Shield). O volume of 5µl of the PCR product was loaded on a gel for confirmation of the reaction ...
-
bioRxiv - Microbiology 2019Quote: ... RNA was extracted from 1−3 × 106 cells using the Quick-RNA Miniprep Kit (Zymo Research) as per manufacturer’s instructions ...
-
bioRxiv - Microbiology 2022Quote: RNA was extracted from Calu-3 lysates using Direct-zol RNA Miniprep Plus Kit (Zymo Research) and reverse transcribed using High-Capacity cDNA RT kit (Applied Biosystems ...
-
bioRxiv - Genetics 2024Quote: CO (n=3) were pooled together for RNA extraction using Quick-RNA Miniprep Kit (Zymo Research) according to the manufacturer’s instructions ...
-
bioRxiv - Molecular Biology 2021Quote: ... Reactions were incubated overnight at 16°C and were terminated using RNA Clean & Concentrator (Zymo Research). Crosslink reversal was done by irradiating the RNA with 2.5 KJ/m2 254 nm UVC using a CL-1000 crosslinker (UVP ...
-
bioRxiv - Genomics 2020Quote: ... for 60 min at 50 °C and subsequently purified using Oligo Clean & Concentrator kit (Zymo Research) and analyzed for oxidized 5mC modifications using liquid chromatography-mass spectrometry/mass spectrometry (LC-MS/MS ...
-
bioRxiv - Developmental Biology 2023Quote: ... 60 min at 55 °C) and cleaned using a ChIP DNA Clean & Concentrator kit (Zymo Research). The chromatin was quality-controlled (QC ...
-
bioRxiv - Synthetic Biology 2020Quote: ... were pretreated with a solution of β-mercaptoethanol plus 60 mM EDTA and then incubated with 6 U/mL zymolyase (Zymo Research) in Buffer I to remove the cell wall ...
-
bioRxiv - Microbiology 2022Quote: ... 6-10 aphids colonized with fluorescent bacteria from each condition were collected and crushed in DNA/RNA shield (Zymo Research, CA, USA). Whole aphid RNA was purified using an RNA Clean & Concentrator kit (Zymo Research ...
-
bioRxiv - Cancer Biology 2023Quote: In vitro-infected keratinocytes and SCC cells were lysed in 6-wells with 1mL TRIzol Reagent and the RNA was purified by using the Direct-zol™ RNA Miniprep kit (Zymo Research). The procedure was performed according to the manufacturer protocol except for an additional 1 min centrifugation after the last washing step to completely remove eventual ethanol leftover ...
-
bioRxiv - Plant Biology 2023Quote: ... Each biological replicated was generated by pooling three individual ChIP pull-downs (each consisting of 6 g of whole seedling tissues) during DNA purification using the ChIP DNA Clean & Concentrator Kit (Zymo Research, D5201). The samples were sent to BGI Genomics for library preparation and sequencing using DNBSEQ ...
-
bioRxiv - Neuroscience 2023Quote: ... RNA from three biological replicates of vehicle-treated (Veh) and 48 h-TTX-treated (TTX) neurons (6 samples in total) were isolated using Quick-RNA Microprep kit (Zymo Research, R1051) according to the instructions of manufacturer ...
-
bioRxiv - Cell Biology 2020Quote: RNA was extracted from 3 x 105 Raji cells using Direct-zolTM RNA MiniPrep kit (Zymo Research) according to manufacturers’ instructions ...
-
bioRxiv - Cancer Biology 2021Quote: ... 3 aliquots were collected in 1 ml stabilization buffer tubes (DNA/RNA Shield, Zymo Research, Irvine, California) using sterile swabs ...
-
bioRxiv - Physiology 2024Quote: ... and KI-TTL mice (N=3 per group) using the Direct-zol RNA Microprep Kit (Zymo Research) followed by a DNase digestion step ...
-
bioRxiv - Genetics 2021Quote: ... We purified reactions using Zymo DNA Clean and Concentrator-5 kit (Zymo D4013) following manufacturer protocols and eluted with 10.5μL water to recover 10μL ...
-
bioRxiv - Molecular Biology 2021Quote: ... and RNA was selectively recovered with RNA clean and concentrator-5 (Zymo Research). RNA fragments were then 5’ phosphorylated with T4 polynucleotide kinase in T4 PNK buffer ...
-
bioRxiv - Developmental Biology 2020Quote: ... and further purified using the RNA Clean & Concentrator-5 kit (Zymo Research, R1013). Samples were treated 30 minutes with TURBO DNase per manufacturer protocol (Thermo Fisher ...
-
bioRxiv - Developmental Biology 2021Quote: ... and supplemented with 1mg/mL Proteinase K (Zymo Research, Cat#: D3001-2-5) for 1 hour at 55°C ...
-
bioRxiv - Molecular Biology 2021Quote: ... DNA was purified with a DNA Clean & Concentrator-5 Kit (Zymo Research, D4013) according to the manufacturer’s protocol ...
-
bioRxiv - Molecular Biology 2020Quote: ... The RNA purification was performed using RNA Clean & Concentrator-5 kit (Zymo Research) as described by manufacturer ...
-
bioRxiv - Genomics 2020Quote: ... gDNA fragments were purified using the DNA Clean & Concentrator-5 kit (Zymo Research).
-
bioRxiv - Cell Biology 2019Quote: ... Cells were resuspended in 50 μL KMS with 5 U Zymolyase (Zymo E1004) for 20 min at 37 °C ...
-
bioRxiv - Molecular Biology 2019Quote: ... 10 ul M-Digestion Buffer and 1ml Proteinase K (Zymo D3001-2-5) were added and incubated for 20 minutes at 50°C ...
-
bioRxiv - Genetics 2019Quote: ... Genomic DNA was used for global (5-mC DNA ELISA Kit -Zymo Research) and specific (satellite I region – BS-PCR ...
-
bioRxiv - Cancer Biology 2019Quote: ... Transposed DNA was purified using a DNA Clean & Concentrator-5 kit (Zymo Research) in 10 μl nuclease-free H2O and amplified with NEBNext® High-Fidelity 2X PCR Master Mix and 1.25 M of custom Nextera PCR primers as previously described(8) ...
-
bioRxiv - Genetics 2019Quote: ... The fragmented mRNA was purified by RNA Clean & Concentrator-5 kit (ZYMO Research) and eluted into 20 ul RNase-free water ...
-
bioRxiv - Genetics 2021Quote: ... RNA samples were purified with an RNA Clean & Concentrator-5 (Zymo Research, R1015), and cDNA generated as described ...
-
bioRxiv - Genetics 2020Quote: ... Tagged DNA was purified with the DNA Clean & Concentrator-5 kit (Zymo Research) eluting with 14 µl EB buffer (Qiagen) ...
-
bioRxiv - Cancer Biology 2020Quote: ... The cDNA products were concentrated using cDNA Clean & Concentrator-5 Kit (Zymo Research) followed bead cleanup using 0.6X AMPure XP Beads (Beckman Coulter ...
-
bioRxiv - Synthetic Biology 2021Quote: ... These libraries were purified using the DNA Clean & Concentrator™-5 kit (Zymo) and eluted in water ...
-
bioRxiv - Synthetic Biology 2021Quote: ... The resulting crRNA was purified using RNA Clean & ConcentratorTM-5 kit (Zymo Research), and subsequently quantified using a NanoDrop 2000 spectrophotometer (Thermo Fisher Scientific) ...
-
bioRxiv - Microbiology 2020Quote: ... RNA was cleaned using the Zymo Clean and Concentrate 5 column (Zymo Research) and eluted in 2x 20 μL (final 40 μL) ...
-
bioRxiv - Genomics 2021Quote: ... Reactions were pooled and purified by DNA Clean and Concentrator 5 (Zymo Research). pLCv2-opti-stuffer-mCherry was digested as described 41 ...
-
bioRxiv - Neuroscience 2022Quote: ... the product was purified with the DNA Clean & Concentrator-5 Kit (Zymo Research). 20 μl tagmented DNA was PCR amplified with NEBNext High-Fidelity PCR Master mix and forward and reverse UDI primers ...
-
bioRxiv - Developmental Biology 2022Quote: Linearized plasmid DNA was cleaned using DNA Clean & concentrator-5 (Zymo Research #D4014). In situ hybridization was completed according to a standard protocol (Cunningham and Monk ...
-
bioRxiv - Molecular Biology 2022Quote: ... The product was cleaned up using RNA Clean & Concentrator-5 kit (ZYMO, R1013) and added into 20 μl of reverse transcription and strand-switching reaction containing 100 nM custom primer (5’ - phos/ ACTTGCCTGTCGCTCTATCTTCATTGATGGTGCCTACAG - 3’) ...
-
bioRxiv - Molecular Biology 2022Quote: ... rRNA-depleted RNA was purified by RNA Clean & Concentrator-5 kit (ZYMO, R1013) and then ligated to 50 pmol 3’ adapter (5’-rAppCTGTAGGCACCATCAAT - NH2-3’ ...
-
bioRxiv - Microbiology 2022Quote: ... The DMS-modified RNA was purified using RNA Clean and ConcentratorTM-5 (Zymo) and eluted in 10µl water.
-
bioRxiv - Genetics 2022Quote: ... followed by another round of clean up (Zymo RNA Clean and Concentrator 5). The final sequence of the spike-in mRNA is ...
-
bioRxiv - Bioengineering 2022Quote: ... DNA products were purified using the DNA Clean & Concentrator-5 Kit (Zymo Research). All purified PCR products were visually checked for expected size via 1% agarose gel electrophoresis and assessed for purity and yield via Nanodrop (Thermo Fisher Scientific).
-
bioRxiv - Microbiology 2020Quote: ... and subsequently purified using the RNA Clean and Concentrate −5 kit (Zymo Research). RNA was then prepped for deep-sequencing using the TruSeq Stranded mRNA Library Preparation Kit (Illumina ...
-
bioRxiv - Plant Biology 2021Quote: ... The remaining RNA was recovered with RNA Clean & Concentrator-5 (Zymo Research, USA). RNA fragments ranging from 200–1000 nucleotides in size were validated on an Agilent 2100 Bioanalyzer.
-
bioRxiv - Molecular Biology 2022Quote: ... Eluted RNA was purified with Zymo RNA Clean & Concentrator-5 columns (Zymo Research), reverse-transcribed with SuperScript IV (ThermoFisher Scientific) ...