Labshake search
Citations for Zymo Research :
4701 - 4750 of 6585 citations for Rat Nuclear Receptor Subfamily 4 Group A Member 2 NR4A2 ELISA Kit since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Molecular Biology 2024Quote: ... The band at roughly 3 kb was extracted using a Zymoclean Gel DNA Recovery Kit (Zymo Research) according to the manufacturer’s protocol ...
-
bioRxiv - Microbiology 2024Quote: ... Genomic DNA was extracted from the pools using the Quick-DNA Fungal/Bacterial Miniprep Kit from Zymo Research (Cat ...
-
bioRxiv - Molecular Biology 2024Quote: ... and RNA was extracted according to the manufacturer’s instructions (Zymo Direct-zol RNA Kits, Cat. No. R2061). 5 μg of total RNA without poly(A ...
-
bioRxiv - Microbiology 2024Quote: ... after which their genomic DNA was extracted using the Quick-DNA Midiprep Plus Kit (ZYMO Research, #D4075). DNA fragments containing the sgRNA sequences were amplified by PCR using primers lentiGuidePCR1-F (AATGGACTATCATATGCTTACCGTAACTTGAAAGTATTTCG ...
-
bioRxiv - Microbiology 2024Quote: RNA was extracted from oyster powder (individual) by using the Direct-Zol RNA miniprep kit (Zymo Research) according to the manufacturer’s protocol ...
-
bioRxiv - Molecular Biology 2024Quote: Total RNA was isolated from mouse tissues using the Quick-RNA MiniPrep kit (#R1055, Zymo Research, USA) according to manufacturer’s instructions ...
-
bioRxiv - Systems Biology 2024Quote: ... The crude DNA extracts were purified by a Zymo DNA Clean & Concentrator™-5 kit (Zymo Research) prior to PCR amplification and NGS sequencing.
-
bioRxiv - Plant Biology 2024Quote: ... DNase I digestion and RNA cleaning were performed with an RNA Clean & Concentrator kit (Zymo Research Europe). The concentration and integrity of the RNA were verified using a QubitTM RNA HS Assay Kit (Invitrogen ...
-
bioRxiv - Genomics 2024Quote: ... Total RNA cleanup was performed by the Zymo RNA clean and concentrator kit (Zymo Research cat# R1013), per the manufacturer’s protocol ...
-
bioRxiv - Genomics 2024Quote: ... 25 ng of genomic DNA was bisulfite converted with the EZ DNA Methylation-Lightning Kit (Zymo Research) per the manufacturer’s protocol ...
-
bioRxiv - Plant Biology 2024Quote: ... Total RNA extraction was performed using the Direct-zol RNA Miniprep kit (Zymo Research, Nordic BioSite, Sweden) with a modified protocol ...
-
bioRxiv - Developmental Biology 2024Quote: ... 500ng of genomic DNA was used for bisulfite conversion with the EZ DNA Methylation Kit (Zymo Research), following the manufacturer’s protocol ...
-
bioRxiv - Molecular Biology 2024Quote: ... Total RNA was then extracted from these cells using the Direct-zol RNA Microprep Kit (Zymo Research), following the manufacturer’s instructions ...
-
bioRxiv - Synthetic Biology 2024Quote: ... and yeast plasmid DNA was extracted via plasmid DNA miniprep using Yeast Miniprep kit II (Zymo Research) then sequenced via whole plasmid Oxford nanopore sequencing to determine the successful expression cassette combinations.
-
bioRxiv - Synthetic Biology 2024Quote: ... BACs containing individual recoded chromosomal regions were isolated using the ZR BAC DNA Miniprep Kit (Zymo Research) based on the manufacturer’s protocol and 500-1000 ng BAC DNA was electroporated into recipient cells using our standard electroporation protocol2 ...
-
bioRxiv - Synthetic Biology 2024Quote: ... Modifications included the use of the Zymo Research RNA Clean & Concentrator-5 kit (R1015, Zymo Research, USA) for RNA purification and recovery instead of AMPure XP beads and the use of heat-denaturation to release streptavidin-bound 3’-Desthiobiotin-GTP (New England Biolabs ...
-
bioRxiv - Synthetic Biology 2024Quote: ... BACs containing individual recoded chromosomal regions were isolated using the ZR BAC DNA Miniprep Kit (Zymo Research) based on the manufacturer’s protocol ...
-
bioRxiv - Neuroscience 2024Quote: ... An RNA preparation kit is used to extract purified RNA from the homogenized tissue (Zymo Research #R2052). After using a nanodrop to confirm the concentration of RNA in each sample ...
-
bioRxiv - Plant Biology 2024Quote: ... Total RNA was extracted from all frozen samples using the Direct-zol RNA MiniPrep kit (Zymo Research) according to the manufacturer’s recommendations ...
-
bioRxiv - Neuroscience 2024Quote: ... Cells were lysed using lysis buffer from the Quick-DNA/RNA Microprep Plus Kit (D7005, Zymo Research), and flow-through protein was separated according to the manufacturer’s instructions ...
-
bioRxiv - Molecular Biology 2024Quote: Total RNA was extracted from parasites of different morphologies with a Direct-zol extraction kit (Zymo Research). RNA samples were quantified by UV‒Vis ...
-
bioRxiv - Animal Behavior and Cognition 2024Quote: ... cDNA synthesis was immediately followed by a cleanup step using a DNA Clean & Concentrator Kit (Zymo Clean).
-
bioRxiv - Plant Biology 2019Quote: ... Euroscarf) was transformed with pAG303GAL-Bax or pAG303GAL-GFP using a Frozen-EZ yeast transformation kit (Zymo Research). Transformants (termed Bax1 and GFP1 ...
-
bioRxiv - Synthetic Biology 2021Quote: ... 200 µL samples and plasmids from each sample were isolated using a Zymo Yeast Miniprep Kit (Zymo Research). Splitting into separate samples here was done to accommodate the capacity of the Yeast Miniprep Kit ...
-
bioRxiv - Cancer Biology 2021Quote: ... Fragments generated by the Tn5 transposase were purified using the DNA Clean and Concentrate kit (Zymo Research, #D4014). Uniquely indexed libraries were obtained by amplification of the purified fragments with indexed primers using 10 cycles of PCR (5 min x 72 °C ...
-
bioRxiv - Developmental Biology 2021Quote: ... a mouse 110 kb BAC clone encoding Nctc1 and Igf2 was purchased from Thermo Fisher Scientific (RPCI23.C) and the DNA was prepared with a ZR BAC DNA Miniprep kit (Zymo Research (D4048)) as control ...
-
bioRxiv - Developmental Biology 2021Quote: ... The resulting DNA was purified using columns and reagents from the EZ DNA Methylation Direct kit (Zymo Research). First-strand synthesis was performed with Klenow Exo-enzyme (New England Biolabs ...
-
bioRxiv - Cell Biology 2020Quote: ... and 250ng of DNA was bisulfite converted per sample using the EZ DNA Methylation-Gold kit (Zymo Research) according to the manufactuer’s protocol ...
-
bioRxiv - Cell Biology 2020Quote: ... The supernatant was collected and total RNA were extracted with Direct-zol RNA MiniPrep Plus kit (Zymo Research) according to the manufacturer’s instructions ...
-
bioRxiv - Cell Biology 2020Quote: ... the plasmid DNA was purified using the ZR Plasmid Miniprep™ Classic Kit (Zymo Research; Irvine, CA, USA) and sequenced (Eurofins MWG Operon GmbH Ebersberg ...
-
bioRxiv - Cell Biology 2020Quote: ... mixed with two volumes of 100% ethanol and purified using an RNA Clean & Concentrator-25 kit (Zymo Research) as per the manufacturer’s instructions ...
-
bioRxiv - Genetics 2021Quote: ... Final clean-up of the amplified library was performed using the DNA clean and concentration kit (Zymo #D4014) and DNA amplicons eluted in 20 μl of H2O ...
-
bioRxiv - Developmental Biology 2021Quote: ... The purified fragments were treated with sodium bisulfite using an EZ DNA Methylation-Gold Kit (Zymo Research D5005). Library amplification and indexing were performed with KAPA HiFi HotStart Uracil+ ReadyMix (2× ...
-
bioRxiv - Genetics 2021Quote: ... RNA was isolated from primary rib chondrocyte cells cultures by using the Directzol-RNA Mini Prep Kit (ZYMO). The purified RNA samples were transcribed to cDNA for miR140-3p and -5p using miRNA cDNA kit (QuantaBio ...
-
bioRxiv - Genetics 2021Quote: ... The microbial DNA was extracted using the Quick-DNA Fecal Microbe Miniprep Kit™ (Zymo Research, Freiburg, Germany) and a 15 min bead-beating step at 30 Hz was applied ...
-
bioRxiv - Genetics 2020Quote: ... and total RNA was extracted 36 hours post-transfection using the Quick-RNA MiniPrep Plus kit (ZYMO Research). Using a primer specific to the 3′ native exon of the pET01 vector ...
-
bioRxiv - Molecular Biology 2020Quote: Total RNA was isolated from whole cells for qRT-PCR using Quick RNA miniprep plus kit from Zymo Research following the manufacturer’s instructions ...
-
bioRxiv - Immunology 2021Quote: ... containing 1% pME and total RNA was isolated using the Quick-RNA MicroPrep Kit (Zymo Research, 11-328M). All subsequent RNA was used for reverse transcription using random hexamer and oligo dT primers with SuperScriptll (ThermoFisher ...
-
bioRxiv - Plant Biology 2021Quote: ... while total RNA from ovules was isolated using the Direct-zol RNA Microprep Kits (Zymo Research, Cat# R2061). 1.0 μg total RNA (0.1-0.5 μg for ovules ...
-
bioRxiv - Molecular Biology 2021Quote: ... or the Direct-zol RNA MiniPrep kit including the recommended DNase I treatment (Zymo Research; all other samples) according to manufacturer’s instructions ...
-
bioRxiv - Microbiology 2021Quote: ... The obtained genomic DNA was purified using the Soil Microbe DNA kit MiniPrep ZR™ (Zymo Research, USA) according to the manufacturer’s instructions ...
-
bioRxiv - Evolutionary Biology 2021Quote: ... RNA was extracted using a modified Zymo RNA Clean and Concentrator 5 kit (Zymo Research, Irvine, CA, USA). Samples were thawed on ice and 200 μL of chloroform was added ...
-
bioRxiv - Evolutionary Biology 2021Quote: We extracted total RNA from each sample using the Quick-RNA tissue/Insect RNA extraction kit (Zymo Research). The RNA quality of each sample was assessed on an Agilent Bioanalyzer ...
-
bioRxiv - Developmental Biology 2020Quote: Total RNA from FACS-sorted hPSC-derived cardiomyocytes was isolated using the Quick-RNA microprep kit (Zymo Research) and submitted to the NYU Genomics Facility for QC ...
-
bioRxiv - Plant Biology 2022Quote: ... Bisulfite conversion had been carried out with the EZ DNA Methylation-Lightning Kit (Zymo Research, Irvine, CA, USA). Libraries were quantified using the Kapa Illumina GA with Revised Primers-SYBR Fast Universal kit (Kapa Biosystems ...
-
bioRxiv - Neuroscience 2021Quote: ... to remove contaminating DNA and was clean and concentrated with RNA Clean and Concentrator-25 Kit (Zymo Research). 1 µg of cleaned RNA was used to generate cDNA with iScript reverse transcriptase per the manufacturer’s protocol (Bio-Rad) ...
-
bioRxiv - Molecular Biology 2020Quote: ... total RNA was extracted from the two transformed lines of 293T cells using RNA Miniprep kit (Zymo Research). For cDNA to be used in RT-PCR ...
-
bioRxiv - Molecular Biology 2021Quote: ... The RNAs were purified from the eluates using an RNA Clean & Concentrator™-5 kit (R1015, Zymo Research) according to the manufacturer’s manual ...
-
bioRxiv - Molecular Biology 2021Quote: ... Bisulfite conversion was performed on 500μg of DNA using Zymo EZ-96 DNA methylation Kit (Zymo Research, USA). DNA methylation profiling was performed using the Illumina Infinium HumanMethylation 450K array (Illumina ...
-
bioRxiv - Molecular Biology 2021Quote: Genomic DNA (400 ng) from mouse tail was bisulphite converted with the EZ DNA Methylation-Lightning kit (Zymo Research ...