Labshake search
Citations for Zymo Research :
4651 - 4700 of 6579 citations for Hemoglobin Colorimetric Detection Kit 2 plate since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2023Quote: Genomic DNA was extracted from the frozen cell pellets using ZymoBIOMICS DNA Miniprep Kits (Zymo Research, #D4300) following the manufacturer’s instructions with the following modifications ...
-
bioRxiv - Microbiology 2023Quote: RNA samples from yeast strain producing different Cab1 variants were extracted using YeaStar RNA kit (Zymo Research).
-
bioRxiv - Molecular Biology 2023Quote: ... RNA was isolated from the upper aqueous phase using the RNA Clean & Concentrator-5 kit (Zymo Research) and eluted in 15 μL RNase-free water ...
-
bioRxiv - Microbiology 2023Quote: ... total RNA was extracted from the samples using Direct-zol RNA miniprep kit (Zymo Research, Orange, CA) with modifications ...
-
bioRxiv - Cell Biology 2023Quote: Total RNA from 5-10×105 cells was extracted using Quick-RNA MiniPrep Plus kit (Zymo Research) followed by reverse transcription using High-Capacity cDNA Reverse Transcription Kit (Thermo Fisher Scientific) ...
-
bioRxiv - Cancer Biology 2023Quote: ... The RNA from the flow through was isolated using the RNA Clean and Concentrator-25 kit (Zymo). In parallel ...
-
bioRxiv - Microbiology 2023Quote: ... Purified RNA was concentrated with the RNA Clean and Concentrator-5 kit (R1013, Zymo Research, Irvine, CA) with a second DNAse I step ...
-
bioRxiv - Systems Biology 2023Quote: ... Total RNA libraries were prepared using the Zymo-Seq RiboFree Total RNA-Seq Library Kit (Zymo Research), using 1000ng of RNA per sample ...
-
bioRxiv - Genomics 2023Quote: ... Genomic DNA (100ng) was bisulfite-converted with the EZ-DNA Methylation-Gold kit (Zymo, Irvine, CA, USA) prior to preparation of the library with the Accel-NGS Methyl-Seq DNA Library Kit (Swift Biosciences ...
-
bioRxiv - Neuroscience 2023Quote: ... NPCs and d30 motor neurons was harvested and purified using the Quick RNA miniprep kit (R1054 Zymo) following the manufacturer guidelines ...
-
bioRxiv - Molecular Biology 2023Quote: ... 60% of the bead beating volume was transferred to the Quick-RNA Miniprep Plus kit (Zymo Research), and RNA was purified using the manufacturer’s protocol for gram positive bacteria ...
-
bioRxiv - Genomics 2023Quote: ... followed by reverse crosslinking (as above) and DNA purification with ChIP DNA Clean and Concentrator kit (Zymo). Sequencing libraries were prepared from 1-5ng ChIP DNA using the NEBNext Ultra II DNA Library Prep kit with NEBNext Single indices (E7645 ...
-
bioRxiv - Cell Biology 2023Quote: Global DNA methylation was performed in genomic DNA using 5-mC DNA ELISA kit (Zymo Research, USA) following manufacturer’s protocol and that described in (Valdivieso et al. ...
-
bioRxiv - Genetics 2023Quote: ... the aqueous phase containing RNA was put through the RNA Clean & Concentrator-5 kit (Zymo Research R1013) with DNase I digestion to remove genomic DNA contamination.
-
bioRxiv - Systems Biology 2023Quote: ... The crude DNA extracts were purified by a Zymo DNA Clean & Concentrator™-5 kit (Zymo Research) prior to PCR amplification and then NGS sequencing was performed.
-
bioRxiv - Immunology 2024Quote: ... RNA cleanup was performed by passing isolated RNA through silica columns (RNA Clean & Concentrator kit, Zymo Research.). cDNA was reverse transcribed from 0.35ug RNA with OmniScript Reverse Transcriptase (Qiagen) ...
-
bioRxiv - Molecular Biology 2024Quote: ... The exonuclease reactions were cleaned up with the RNA Clean & Concentrator kit (8X ethanol method; Zymo Research). An aliquot of this material for synthesized FLEXIs was analyzed on a Novex 10% TBE-Urea polyacrylamide gel (Thermo Fisher ...
-
bioRxiv - Cancer Biology 2024Quote: ... Replicates were single batch processed for RNA isolation using the Direct-zol RNA Miniprep Kit (Zymo Research) and RNA quality was determined using an Agilent Bioanalyzer DNA High sensitivity chip ...
-
bioRxiv - Neuroscience 2024Quote: ... Bisulfite conversion was performed with the EZ-96 DNA methylation kit (shallow; Zymo Research Corporation, Irvine, USA). DNA methylation levels were then measured on two arrays ...
-
bioRxiv - Cancer Biology 2024Quote: Total RNA from cells and tissue was isolated using Direct-zolTM RNA Miniprep kit (Zymo Research, R2052). Prior to RNA purification tissue was crushed under liquid Nitrogen and 25-50 mg of tissue-powder lysed in 800ml Ambion TRIzol Reagent (Invitrogen™,15596018 ...
-
bioRxiv - Neuroscience 2024Quote: ... and sheared DNA was bisulfite converted using the EZ DNA Methylation-Gold kit (Zymo Research, Cat. #D5005) with an elution volume of 15 µL ...
-
bioRxiv - Neuroscience 2024Quote: ... Genomic DNA of individual flies was extracted using the ZR-96 Quick-gDNA MiniPrep kit (Zymo Research).
-
bioRxiv - Cancer Biology 2024Quote: The chromatin immunoprecipitation (ChIP) assay was performed using the Zymo-Spin ChIP kit (Zymo Research, CA #D5210) according to manufacturer’s instructions ...
-
bioRxiv - Cancer Biology 2024Quote: RNA (>200 nucleotides) was purified from cells using the Quick-RNA MiniPrep Plus Kit (Zymo Research, #R1057). The quality control check on RNA-seq reads was performed with FastQC v0.11.7 ...
-
bioRxiv - Cancer Biology 2024Quote: ... the lysates were thawed on ice and RNA was extracted using Quick-RNA Miniprep Kit (Zymo Research). RNA concentration was measured using nanodrop and then 1 µg of total RNA from each sample was taken for cDNA synthesis using High-Capacity cDNA Reverse Transcription Kit (Applied Biosystems) ...
-
bioRxiv - Pathology 2024Quote: ... The sequence reaction was purified using the ZR DNA Sequencing Clean-Up Kit (Zymo Research, California, USA) and analyzed using an ABI PRISM 310 Genetic Analyzer (Applied Biosystems ...
-
bioRxiv - Microbiology 2024Quote: ... RNA extraction was performed using the Quick-RNA Fungal/Bacterial Miniprep kit (Zymo Research, Irvine, CA, USA), following the manufacturer’s instructions and as we described (82) ...
-
bioRxiv - Cell Biology 2024Quote: ... Eluted RNA was purified using an RNA Clean and Concentrator-5 Kit (Zymo Research, cat. #R1015/R1016) and taken through reverse transcription ...
-
bioRxiv - Microbiology 2024Quote: Genomic DNA was extracted from bacteria or phage using the Zymo gDNA prep kit (Zymo Research, Corp) or the Promega Wizard kit (Promega ...
-
bioRxiv - Microbiology 2024Quote: ... DNA was extracted from surface sterilized samples with the ZymoBIOMICS DNA Mini kit (Zymo Research, Irvine, CA) following the manufacturer’s protocol with samples bead beaten on the homogenize setting for 1 min using a BioSpec Products mini-bead beater ...
-
bioRxiv - Microbiology 2024Quote: ... followed by isopropanol precipitation for large rRNA yields or using Direct-zol RNA miniprep kit (Zymo Research) for low RNA quantities ...
-
bioRxiv - Microbiology 2024Quote: ... The total RNA was extracted from cell lysates using Direct-zol RNA Miniprep Plus Kit (Zymo Research) and reverse-transcribed using High-Capacity cDNA RT kit (Applied Biosystems) ...
-
bioRxiv - Molecular Biology 2024Quote: ... The band at roughly 3 kb was extracted using a Zymoclean Gel DNA Recovery Kit (Zymo Research) according to the manufacturer’s protocol ...
-
bioRxiv - Microbiology 2024Quote: ... Genomic DNA was extracted from the pools using the Quick-DNA Fungal/Bacterial Miniprep Kit from Zymo Research (Cat ...
-
bioRxiv - Molecular Biology 2024Quote: ... and RNA was extracted according to the manufacturer’s instructions (Zymo Direct-zol RNA Kits, Cat. No. R2061). 5 μg of total RNA without poly(A ...
-
bioRxiv - Microbiology 2024Quote: ... after which their genomic DNA was extracted using the Quick-DNA Midiprep Plus Kit (ZYMO Research, #D4075). DNA fragments containing the sgRNA sequences were amplified by PCR using primers lentiGuidePCR1-F (AATGGACTATCATATGCTTACCGTAACTTGAAAGTATTTCG ...
-
bioRxiv - Microbiology 2024Quote: RNA was extracted from oyster powder (individual) by using the Direct-Zol RNA miniprep kit (Zymo Research) according to the manufacturer’s protocol ...
-
bioRxiv - Molecular Biology 2024Quote: Total RNA was isolated from mouse tissues using the Quick-RNA MiniPrep kit (#R1055, Zymo Research, USA) according to manufacturer’s instructions ...
-
bioRxiv - Systems Biology 2024Quote: ... The crude DNA extracts were purified by a Zymo DNA Clean & Concentrator™-5 kit (Zymo Research) prior to PCR amplification and NGS sequencing.
-
bioRxiv - Plant Biology 2024Quote: ... DNase I digestion and RNA cleaning were performed with an RNA Clean & Concentrator kit (Zymo Research Europe). The concentration and integrity of the RNA were verified using a QubitTM RNA HS Assay Kit (Invitrogen ...
-
bioRxiv - Genomics 2024Quote: ... Total RNA cleanup was performed by the Zymo RNA clean and concentrator kit (Zymo Research cat# R1013), per the manufacturer’s protocol ...
-
bioRxiv - Genomics 2024Quote: ... 25 ng of genomic DNA was bisulfite converted with the EZ DNA Methylation-Lightning Kit (Zymo Research) per the manufacturer’s protocol ...
-
bioRxiv - Plant Biology 2024Quote: ... Total RNA extraction was performed using the Direct-zol RNA Miniprep kit (Zymo Research, Nordic BioSite, Sweden) with a modified protocol ...
-
bioRxiv - Developmental Biology 2024Quote: ... 500ng of genomic DNA was used for bisulfite conversion with the EZ DNA Methylation Kit (Zymo Research), following the manufacturer’s protocol ...
-
bioRxiv - Molecular Biology 2024Quote: ... Total RNA was then extracted from these cells using the Direct-zol RNA Microprep Kit (Zymo Research), following the manufacturer’s instructions ...
-
bioRxiv - Synthetic Biology 2024Quote: ... and yeast plasmid DNA was extracted via plasmid DNA miniprep using Yeast Miniprep kit II (Zymo Research) then sequenced via whole plasmid Oxford nanopore sequencing to determine the successful expression cassette combinations.
-
bioRxiv - Synthetic Biology 2024Quote: ... BACs containing individual recoded chromosomal regions were isolated using the ZR BAC DNA Miniprep Kit (Zymo Research) based on the manufacturer’s protocol and 500-1000 ng BAC DNA was electroporated into recipient cells using our standard electroporation protocol2 ...
-
bioRxiv - Synthetic Biology 2024Quote: ... Modifications included the use of the Zymo Research RNA Clean & Concentrator-5 kit (R1015, Zymo Research, USA) for RNA purification and recovery instead of AMPure XP beads and the use of heat-denaturation to release streptavidin-bound 3’-Desthiobiotin-GTP (New England Biolabs ...
-
bioRxiv - Synthetic Biology 2024Quote: ... BACs containing individual recoded chromosomal regions were isolated using the ZR BAC DNA Miniprep Kit (Zymo Research) based on the manufacturer’s protocol ...
-
bioRxiv - Neuroscience 2024Quote: ... An RNA preparation kit is used to extract purified RNA from the homogenized tissue (Zymo Research #R2052). After using a nanodrop to confirm the concentration of RNA in each sample ...