Labshake search
Citations for Zymo Research :
4601 - 4650 of 6536 citations for Creatinine Serum Kit 4 Plate since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Plant Biology 2024Quote: ... Total RNA extraction was performed using the Direct-zol RNA Miniprep kit (Zymo Research, Nordic BioSite, Sweden) with a modified protocol ...
-
bioRxiv - Synthetic Biology 2024Quote: ... and yeast plasmid DNA was extracted via plasmid DNA miniprep using Yeast Miniprep kit II (Zymo Research) then sequenced via whole plasmid Oxford nanopore sequencing to determine the successful expression cassette combinations.
-
bioRxiv - Developmental Biology 2024Quote: ... 500ng of genomic DNA was used for bisulfite conversion with the EZ DNA Methylation Kit (Zymo Research), following the manufacturer’s protocol ...
-
bioRxiv - Neuroscience 2024Quote: ... An RNA preparation kit is used to extract purified RNA from the homogenized tissue (Zymo Research #R2052). After using a nanodrop to confirm the concentration of RNA in each sample ...
-
bioRxiv - Genomics 2024Quote: ... 25 ng of genomic DNA was bisulfite converted with the EZ DNA Methylation-Lightning Kit (Zymo Research) per the manufacturer’s protocol ...
-
bioRxiv - Genomics 2024Quote: ... Total RNA cleanup was performed by the Zymo RNA clean and concentrator kit (Zymo Research cat# R1013), per the manufacturer’s protocol ...
-
bioRxiv - Immunology 2024Quote: ... RNA cleanup was performed by passing isolated RNA through silica columns (RNA Clean & Concentrator kit, Zymo Research.). cDNA was reverse transcribed from 0.35ug RNA with OmniScript Reverse Transcriptase (Qiagen) ...
-
bioRxiv - Molecular Biology 2024Quote: ... The exonuclease reactions were cleaned up with the RNA Clean & Concentrator kit (8X ethanol method; Zymo Research). An aliquot of this material for synthesized FLEXIs was analyzed on a Novex 10% TBE-Urea polyacrylamide gel (Thermo Fisher ...
-
bioRxiv - Cancer Biology 2024Quote: ... Replicates were single batch processed for RNA isolation using the Direct-zol RNA Miniprep Kit (Zymo Research) and RNA quality was determined using an Agilent Bioanalyzer DNA High sensitivity chip ...
-
bioRxiv - Neuroscience 2024Quote: ... Bisulfite conversion was performed with the EZ-96 DNA methylation kit (shallow; Zymo Research Corporation, Irvine, USA). DNA methylation levels were then measured on two arrays ...
-
bioRxiv - Cancer Biology 2024Quote: Total RNA from cells and tissue was isolated using Direct-zolTM RNA Miniprep kit (Zymo Research, R2052). Prior to RNA purification tissue was crushed under liquid Nitrogen and 25-50 mg of tissue-powder lysed in 800ml Ambion TRIzol Reagent (Invitrogen™,15596018 ...
-
bioRxiv - Cancer Biology 2024Quote: The chromatin immunoprecipitation (ChIP) assay was performed using the Zymo-Spin ChIP kit (Zymo Research, CA #D5210) according to manufacturer’s instructions ...
-
bioRxiv - Cancer Biology 2024Quote: RNA (>200 nucleotides) was purified from cells using the Quick-RNA MiniPrep Plus Kit (Zymo Research, #R1057). The quality control check on RNA-seq reads was performed with FastQC v0.11.7 ...
-
bioRxiv - Neuroscience 2024Quote: ... and sheared DNA was bisulfite converted using the EZ DNA Methylation-Gold kit (Zymo Research, Cat. #D5005) with an elution volume of 15 µL ...
-
bioRxiv - Neuroscience 2024Quote: ... Genomic DNA of individual flies was extracted using the ZR-96 Quick-gDNA MiniPrep kit (Zymo Research).
-
bioRxiv - Microbiology 2024Quote: ... RNA extraction was performed using the Quick-RNA Fungal/Bacterial Miniprep kit (Zymo Research, Irvine, CA, USA), following the manufacturer’s instructions and as we described (82) ...
-
bioRxiv - Pathology 2024Quote: ... The sequence reaction was purified using the ZR DNA Sequencing Clean-Up Kit (Zymo Research, California, USA) and analyzed using an ABI PRISM 310 Genetic Analyzer (Applied Biosystems ...
-
bioRxiv - Cancer Biology 2024Quote: ... the lysates were thawed on ice and RNA was extracted using Quick-RNA Miniprep Kit (Zymo Research). RNA concentration was measured using nanodrop and then 1 µg of total RNA from each sample was taken for cDNA synthesis using High-Capacity cDNA Reverse Transcription Kit (Applied Biosystems) ...
-
bioRxiv - Molecular Biology 2024Quote: ... and RNA was extracted according to the manufacturer’s instructions (Zymo Direct-zol RNA Kits, Cat. No. R2061). 5 μg of total RNA without poly(A ...
-
bioRxiv - Microbiology 2024Quote: ... The total RNA was extracted from cell lysates using Direct-zol RNA Miniprep Plus Kit (Zymo Research) and reverse-transcribed using High-Capacity cDNA RT kit (Applied Biosystems) ...
-
bioRxiv - Cell Biology 2024Quote: ... Eluted RNA was purified using an RNA Clean and Concentrator-5 Kit (Zymo Research, cat. #R1015/R1016) and taken through reverse transcription ...
-
bioRxiv - Systems Biology 2024Quote: ... The crude DNA extracts were purified by a Zymo DNA Clean & Concentrator™-5 kit (Zymo Research) prior to PCR amplification and NGS sequencing.
-
bioRxiv - Plant Biology 2024Quote: ... DNase I digestion and RNA cleaning were performed with an RNA Clean & Concentrator kit (Zymo Research Europe). The concentration and integrity of the RNA were verified using a QubitTM RNA HS Assay Kit (Invitrogen ...
-
bioRxiv - Synthetic Biology 2024Quote: ... BACs containing individual recoded chromosomal regions were isolated using the ZR BAC DNA Miniprep Kit (Zymo Research) based on the manufacturer’s protocol and 500-1000 ng BAC DNA was electroporated into recipient cells using our standard electroporation protocol2 ...
-
bioRxiv - Synthetic Biology 2024Quote: ... Modifications included the use of the Zymo Research RNA Clean & Concentrator-5 kit (R1015, Zymo Research, USA) for RNA purification and recovery instead of AMPure XP beads and the use of heat-denaturation to release streptavidin-bound 3’-Desthiobiotin-GTP (New England Biolabs ...
-
bioRxiv - Molecular Biology 2024Quote: ... Total RNA was then extracted from these cells using the Direct-zol RNA Microprep Kit (Zymo Research), following the manufacturer’s instructions ...
-
bioRxiv - Synthetic Biology 2024Quote: ... BACs containing individual recoded chromosomal regions were isolated using the ZR BAC DNA Miniprep Kit (Zymo Research) based on the manufacturer’s protocol ...
-
bioRxiv - Microbiology 2024Quote: ... followed by isopropanol precipitation for large rRNA yields or using Direct-zol RNA miniprep kit (Zymo Research) for low RNA quantities ...
-
bioRxiv - Molecular Biology 2024Quote: ... The band at roughly 3 kb was extracted using a Zymoclean Gel DNA Recovery Kit (Zymo Research) according to the manufacturer’s protocol ...
-
bioRxiv - Molecular Biology 2024Quote: Total RNA was isolated from mouse tissues using the Quick-RNA MiniPrep kit (#R1055, Zymo Research, USA) according to manufacturer’s instructions ...
-
bioRxiv - Microbiology 2024Quote: ... Genomic DNA was extracted from the pools using the Quick-DNA Fungal/Bacterial Miniprep Kit from Zymo Research (Cat ...
-
bioRxiv - Microbiology 2024Quote: ... after which their genomic DNA was extracted using the Quick-DNA Midiprep Plus Kit (ZYMO Research, #D4075). DNA fragments containing the sgRNA sequences were amplified by PCR using primers lentiGuidePCR1-F (AATGGACTATCATATGCTTACCGTAACTTGAAAGTATTTCG ...
-
bioRxiv - Microbiology 2024Quote: Genomic DNA was extracted from bacteria or phage using the Zymo gDNA prep kit (Zymo Research, Corp) or the Promega Wizard kit (Promega ...
-
bioRxiv - Microbiology 2024Quote: ... DNA was extracted from surface sterilized samples with the ZymoBIOMICS DNA Mini kit (Zymo Research, Irvine, CA) following the manufacturer’s protocol with samples bead beaten on the homogenize setting for 1 min using a BioSpec Products mini-bead beater ...
-
bioRxiv - Microbiology 2024Quote: RNA was extracted from oyster powder (individual) by using the Direct-Zol RNA miniprep kit (Zymo Research) according to the manufacturer’s protocol ...
-
bioRxiv - Neuroscience 2024Quote: ... Cells were lysed using lysis buffer from the Quick-DNA/RNA Microprep Plus Kit (D7005, Zymo Research), and flow-through protein was separated according to the manufacturer’s instructions ...
-
bioRxiv - Molecular Biology 2024Quote: Total RNA was extracted from parasites of different morphologies with a Direct-zol extraction kit (Zymo Research). RNA samples were quantified by UV‒Vis ...
-
bioRxiv - Plant Biology 2024Quote: ... Total RNA was extracted from all frozen samples using the Direct-zol RNA MiniPrep kit (Zymo Research) according to the manufacturer’s recommendations ...
-
bioRxiv - Animal Behavior and Cognition 2024Quote: ... cDNA synthesis was immediately followed by a cleanup step using a DNA Clean & Concentrator Kit (Zymo Clean).
-
bioRxiv - Plant Biology 2019Quote: ... Euroscarf) was transformed with pAG303GAL-Bax or pAG303GAL-GFP using a Frozen-EZ yeast transformation kit (Zymo Research). Transformants (termed Bax1 and GFP1 ...
-
bioRxiv - Synthetic Biology 2021Quote: ... 200 µL samples and plasmids from each sample were isolated using a Zymo Yeast Miniprep Kit (Zymo Research). Splitting into separate samples here was done to accommodate the capacity of the Yeast Miniprep Kit ...
-
bioRxiv - Cancer Biology 2021Quote: ... Fragments generated by the Tn5 transposase were purified using the DNA Clean and Concentrate kit (Zymo Research, #D4014). Uniquely indexed libraries were obtained by amplification of the purified fragments with indexed primers using 10 cycles of PCR (5 min x 72 °C ...
-
bioRxiv - Developmental Biology 2021Quote: ... a mouse 110 kb BAC clone encoding Nctc1 and Igf2 was purchased from Thermo Fisher Scientific (RPCI23.C) and the DNA was prepared with a ZR BAC DNA Miniprep kit (Zymo Research (D4048)) as control ...
-
bioRxiv - Developmental Biology 2021Quote: ... The resulting DNA was purified using columns and reagents from the EZ DNA Methylation Direct kit (Zymo Research). First-strand synthesis was performed with Klenow Exo-enzyme (New England Biolabs ...
-
bioRxiv - Cell Biology 2020Quote: ... and 250ng of DNA was bisulfite converted per sample using the EZ DNA Methylation-Gold kit (Zymo Research) according to the manufactuer’s protocol ...
-
bioRxiv - Cell Biology 2020Quote: ... The supernatant was collected and total RNA were extracted with Direct-zol RNA MiniPrep Plus kit (Zymo Research) according to the manufacturer’s instructions ...
-
bioRxiv - Cell Biology 2020Quote: ... the plasmid DNA was purified using the ZR Plasmid Miniprep™ Classic Kit (Zymo Research; Irvine, CA, USA) and sequenced (Eurofins MWG Operon GmbH Ebersberg ...
-
bioRxiv - Cell Biology 2020Quote: ... mixed with two volumes of 100% ethanol and purified using an RNA Clean & Concentrator-25 kit (Zymo Research) as per the manufacturer’s instructions ...
-
bioRxiv - Genetics 2021Quote: ... Final clean-up of the amplified library was performed using the DNA clean and concentration kit (Zymo #D4014) and DNA amplicons eluted in 20 μl of H2O ...
-
bioRxiv - Developmental Biology 2021Quote: ... The purified fragments were treated with sodium bisulfite using an EZ DNA Methylation-Gold Kit (Zymo Research D5005). Library amplification and indexing were performed with KAPA HiFi HotStart Uracil+ ReadyMix (2× ...