Labshake search
Citations for Zymo Research :
4551 - 4600 of 6633 citations for Parallel Artificial Membrane Permeability Assay PAMPA Kit since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Genomics 2023Quote: ... RNA was extracted and treated with DNaseI using a Direct-zol RNA MiniPrep Plus kit (R2072, Zymo). Purified RNA was reverse transcribed using the SuperScript III First-Strand Synthesis SuperMix for qRT-PCR kit (11752050 ...
-
bioRxiv - Microbiology 2023Quote: ... genomic DNA was extracted with the Quick-DNA™ Fungal/Bacterial Miniprep kit (Zymo Research, Irvine, CA) and purified with the Genomic DNA Clean & Concentrator™ kit (Zymo Research) ...
-
bioRxiv - Biochemistry 2023Quote: ... the precipitated RNA sample was dissolved in ddH2O and cleaned using RNA clean & concentrator kit (Zymo Research). Reverse transcription (RT ...
-
bioRxiv - Plant Biology 2023Quote: ... samples were further cleaned and concentrated using the RNA Clean & ConcentratorTM-25 kit (Zymo Research, Seattle, WA). Concentration of each sample was measured using the Qubit RNA Broad Range kit and Qubit 4 Fluorometer (Thermo Fisher Scientific Inc ...
-
Emergence of RNA-guided transcription factors via domestication of transposon-encoded TnpB nucleasesbioRxiv - Genetics 2023Quote: ... RNA was isolated from the upper aqueous phase using the RNA Clean & Concentrator-5 kit (Zymo Research). RNA from input samples was isolated in the same manner using TRIzol and column purification ...
-
bioRxiv - Immunology 2023Quote: Total RNA was purified from cells or tissues using Direct-zol RNA MiniPrep Kit (Zymo Research, R2072) and TRIzol reagent (Ambion ...
-
bioRxiv - Immunology 2023Quote: RNA was isolated from cells harvested in TRIzol using Direct-zol RNA Miniprep kits (Zymo Research, R2052) with an hour DNase treatment ...
-
bioRxiv - Developmental Biology 2023Quote: ... and total RNA was extracted using the Direct-zol RNA Microprep kit (Zymo Research, Irvine, CA, USA).
-
bioRxiv - Cell Biology 2023Quote: ... total RNA was isolated using Direct-zol RNA miniprep kit (ZYMO research, #R2051 and #R2050-1-50) following the manufacturer’s instruction ...
-
bioRxiv - Synthetic Biology 2023Quote: ... RNA was extracted from frozen cells using Quick-RNA Fungal/Bacterial Miniprep kit (Zymo Research, California, USA) and was reverse transcribed using a PrimeScript RT Reagent Kit (Takara ...
-
bioRxiv - Molecular Biology 2023Quote: Total RNA was isolated from HCT116 cells with the Direct-zol RNA MiniPrep Kit (Zymo Research, #R2053). Library preparation ...
-
bioRxiv - Molecular Biology 2023Quote: ... for 30 min and then total RNA collected using Direct-Zol RNA Miniprep Plus Kit (Zymo, R2070). Bru-labeled nascent RNA was then enriched 47 using anti-BrdU antibodies conjugated to magnetic beads ...
-
bioRxiv - Plant Biology 2023Quote: ... using TRI-Reagent with the Direct-zol RNA MiniPrep Kit according to the manufacturer’s instruction (Zymo Research). RNA concentration ...
-
bioRxiv - Neuroscience 2023Quote: Sorted nuclei DNA on beads were processed by Pico Methyl-Seq Library Prep Kit (Zymo Research, D5455) to generate bisulfite sequencing libraries ...
-
bioRxiv - Neuroscience 2023Quote: Genome-wide DNA methylation levels were determined using the 5-mC DNA ELISA Kit (Zymo Research, D5325) per the manufacturer’s instruction ...
-
bioRxiv - Immunology 2023Quote: ... RNA was isolated as per the manufacturer’s instruction using Direct-zol RNA Miniprep Plus kit (Zymo Research).
-
bioRxiv - Immunology 2023Quote: ... was added to each swab and RNA was extracted using the Zymo Quick RNA Viral Kit (Zymo) according to manufacturer’s instructions ...
-
bioRxiv - Microbiology 2023Quote: Genomic DNA was extracted from the frozen cell pellets using ZymoBIOMICS DNA Miniprep Kits (Zymo Research, #D4300) following the manufacturer’s instructions with the following modifications ...
-
bioRxiv - Microbiology 2023Quote: RNA samples from yeast strain producing different Cab1 variants were extracted using YeaStar RNA kit (Zymo Research).
-
bioRxiv - Molecular Biology 2023Quote: ... RNA was isolated from the upper aqueous phase using the RNA Clean & Concentrator-5 kit (Zymo Research) and eluted in 15 μL RNase-free water ...
-
bioRxiv - Microbiology 2023Quote: ... total RNA was extracted from the samples using Direct-zol RNA miniprep kit (Zymo Research, Orange, CA) with modifications ...
-
bioRxiv - Microbiology 2023Quote: ... Purified RNA was concentrated with the RNA Clean and Concentrator-5 kit (R1013, Zymo Research, Irvine, CA) with a second DNAse I step ...
-
bioRxiv - Systems Biology 2023Quote: ... Total RNA libraries were prepared using the Zymo-Seq RiboFree Total RNA-Seq Library Kit (Zymo Research), using 1000ng of RNA per sample ...
-
bioRxiv - Genomics 2023Quote: ... Genomic DNA (100ng) was bisulfite-converted with the EZ-DNA Methylation-Gold kit (Zymo, Irvine, CA, USA) prior to preparation of the library with the Accel-NGS Methyl-Seq DNA Library Kit (Swift Biosciences ...
-
bioRxiv - Neuroscience 2023Quote: ... NPCs and d30 motor neurons was harvested and purified using the Quick RNA miniprep kit (R1054 Zymo) following the manufacturer guidelines ...
-
bioRxiv - Molecular Biology 2023Quote: ... 60% of the bead beating volume was transferred to the Quick-RNA Miniprep Plus kit (Zymo Research), and RNA was purified using the manufacturer’s protocol for gram positive bacteria ...
-
bioRxiv - Genomics 2023Quote: ... followed by reverse crosslinking (as above) and DNA purification with ChIP DNA Clean and Concentrator kit (Zymo). Sequencing libraries were prepared from 1-5ng ChIP DNA using the NEBNext Ultra II DNA Library Prep kit with NEBNext Single indices (E7645 ...
-
bioRxiv - Cell Biology 2023Quote: Global DNA methylation was performed in genomic DNA using 5-mC DNA ELISA kit (Zymo Research, USA) following manufacturer’s protocol and that described in (Valdivieso et al. ...
-
bioRxiv - Genetics 2023Quote: ... the aqueous phase containing RNA was put through the RNA Clean & Concentrator-5 kit (Zymo Research R1013) with DNase I digestion to remove genomic DNA contamination.
-
bioRxiv - Systems Biology 2023Quote: ... The crude DNA extracts were purified by a Zymo DNA Clean & Concentrator™-5 kit (Zymo Research) prior to PCR amplification and then NGS sequencing was performed.
-
bioRxiv - Neuroscience 2024Quote: ... and sheared DNA was bisulfite converted using the EZ DNA Methylation-Gold kit (Zymo Research, Cat. #D5005) with an elution volume of 15 µL ...
-
bioRxiv - Neuroscience 2024Quote: ... Genomic DNA of individual flies was extracted using the ZR-96 Quick-gDNA MiniPrep kit (Zymo Research).
-
bioRxiv - Cancer Biology 2024Quote: RNA (>200 nucleotides) was purified from cells using the Quick-RNA MiniPrep Plus Kit (Zymo Research, #R1057). The quality control check on RNA-seq reads was performed with FastQC v0.11.7 ...
-
bioRxiv - Cancer Biology 2024Quote: ... the lysates were thawed on ice and RNA was extracted using Quick-RNA Miniprep Kit (Zymo Research). RNA concentration was measured using nanodrop and then 1 µg of total RNA from each sample was taken for cDNA synthesis using High-Capacity cDNA Reverse Transcription Kit (Applied Biosystems) ...
-
bioRxiv - Pathology 2024Quote: ... The sequence reaction was purified using the ZR DNA Sequencing Clean-Up Kit (Zymo Research, California, USA) and analyzed using an ABI PRISM 310 Genetic Analyzer (Applied Biosystems ...
-
bioRxiv - Microbiology 2024Quote: ... RNA extraction was performed using the Quick-RNA Fungal/Bacterial Miniprep kit (Zymo Research, Irvine, CA, USA), following the manufacturer’s instructions and as we described (82) ...
-
bioRxiv - Cell Biology 2024Quote: ... Eluted RNA was purified using an RNA Clean and Concentrator-5 Kit (Zymo Research, cat. #R1015/R1016) and taken through reverse transcription ...
-
bioRxiv - Microbiology 2024Quote: Genomic DNA was extracted from bacteria or phage using the Zymo gDNA prep kit (Zymo Research, Corp) or the Promega Wizard kit (Promega ...
-
bioRxiv - Microbiology 2024Quote: ... DNA was extracted from surface sterilized samples with the ZymoBIOMICS DNA Mini kit (Zymo Research, Irvine, CA) following the manufacturer’s protocol with samples bead beaten on the homogenize setting for 1 min using a BioSpec Products mini-bead beater ...
-
bioRxiv - Microbiology 2024Quote: ... followed by isopropanol precipitation for large rRNA yields or using Direct-zol RNA miniprep kit (Zymo Research) for low RNA quantities ...
-
bioRxiv - Microbiology 2024Quote: ... The total RNA was extracted from cell lysates using Direct-zol RNA Miniprep Plus Kit (Zymo Research) and reverse-transcribed using High-Capacity cDNA RT kit (Applied Biosystems) ...
-
bioRxiv - Molecular Biology 2024Quote: ... The band at roughly 3 kb was extracted using a Zymoclean Gel DNA Recovery Kit (Zymo Research) according to the manufacturer’s protocol ...
-
bioRxiv - Microbiology 2024Quote: ... Genomic DNA was extracted from the pools using the Quick-DNA Fungal/Bacterial Miniprep Kit from Zymo Research (Cat ...
-
bioRxiv - Molecular Biology 2024Quote: ... and RNA was extracted according to the manufacturer’s instructions (Zymo Direct-zol RNA Kits, Cat. No. R2061). 5 μg of total RNA without poly(A ...
-
bioRxiv - Microbiology 2024Quote: ... after which their genomic DNA was extracted using the Quick-DNA Midiprep Plus Kit (ZYMO Research, #D4075). DNA fragments containing the sgRNA sequences were amplified by PCR using primers lentiGuidePCR1-F (AATGGACTATCATATGCTTACCGTAACTTGAAAGTATTTCG ...
-
bioRxiv - Microbiology 2024Quote: RNA was extracted from oyster powder (individual) by using the Direct-Zol RNA miniprep kit (Zymo Research) according to the manufacturer’s protocol ...
-
bioRxiv - Molecular Biology 2024Quote: Total RNA was isolated from mouse tissues using the Quick-RNA MiniPrep kit (#R1055, Zymo Research, USA) according to manufacturer’s instructions ...
-
bioRxiv - Systems Biology 2024Quote: ... The crude DNA extracts were purified by a Zymo DNA Clean & Concentrator™-5 kit (Zymo Research) prior to PCR amplification and NGS sequencing.
-
bioRxiv - Plant Biology 2024Quote: ... DNase I digestion and RNA cleaning were performed with an RNA Clean & Concentrator kit (Zymo Research Europe). The concentration and integrity of the RNA were verified using a QubitTM RNA HS Assay Kit (Invitrogen ...
-
bioRxiv - Genomics 2024Quote: ... Total RNA cleanup was performed by the Zymo RNA clean and concentrator kit (Zymo Research cat# R1013), per the manufacturer’s protocol ...