Labshake search
Citations for Zymo Research :
401 - 450 of 946 citations for Dengue Virus Serotype 1 Envelope Protein Insect Cells since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Systems Biology 2022Quote: ... This flow through was discarded and 1 volume of DNA/RNA Prep buffer (Zymo) was added then centrifuged ...
-
bioRxiv - Immunology 2022Quote: ... Additional tissues were treated using TRIzol reagent (Zymo Research Catalog No R2050-1-200) at a ratio of at least 1:1 or fixed with 10% neutral-buffered formalin before additional work in BSL2 conditions.
-
bioRxiv - Developmental Biology 2020Quote: ... 1 μL CircLigase) for 12 hours at 60°C and subsequently purified by Zymo RNA Clean & Concentrator 5 columns (100 μL sample ...
-
bioRxiv - Microbiology 2023Quote: ... 1) Amplification of a ZymoBIOMICS Microbial Community DNA Standard (Zymo Research, Irvine, CA U.S.A.) and 2 ...
-
bioRxiv - Microbiology 2023Quote: ... Samples were immediately stored in 1 ml of DNA/RNA Shield presentation buffer (Zymo) and frozen at -20°C until DNA extraction.
-
bioRxiv - Bioengineering 2021Quote: Total RNA extracted from cultivated cells with DirectZol™ RNA MiniPrep (Zymo Research, Irvine, California, USA). The RNA samples (1 μg each ...
-
bioRxiv - Cancer Biology 2021Quote: ... Cells were pelleted and RNA was isolated using a Quick-RNA™ MiniPrep (#R1055, Zymo Research) according to manufacturer instructions ...
-
bioRxiv - Developmental Biology 2021Quote: ... 3 and 4 by lysing cells in the 6-well plate in RNA lysis buffer (Zymo) and freezing at −80 °C until extraction ...
-
bioRxiv - Developmental Biology 2021Quote: ... 2i mESCs and differentiating cells by first extracting RNA using a Quick-RNA Miniprep Kit (Zymo) with DNase I treatment according to the manufacturer’s instructions ...
-
bioRxiv - Evolutionary Biology 2021Quote: ... DNA was extracted from blood or cell lines using the Quick-DNA Miniprep kit (Zymo Research), following the manufacturer’s protocol ...
-
bioRxiv - Synthetic Biology 2022Quote: ... Genomic DNA was extracted from sorted cells using the Genomic DNA Clean & Concentrator kit (Zymo Research). PCR fragments were amplified using KAPA HiFi HotStart DNA Polymerase with 2X Master Mix (Roche) ...
-
Histone deacetylase inhibitors butyrate and bufexamac inhibit de novo HIV-1 infection in CD4 T-cellsbioRxiv - Microbiology 2020Quote: RNA was isolated from trizol lysates of cells using Direct-zol RNA Miniprep Kit (Zymo Research) following manufacturer’s instructions ...
-
bioRxiv - Molecular Biology 2019Quote: ... Total RNA was extracted from transfected cells and media with Direct-zol RNA kit (Zymo Research), and DNase I in-column digestion was conducted to remove plasmids ...
-
bioRxiv - Neuroscience 2019Quote: Total RNA was extracted from cell lysates using Direct-zol RNA Mini Prep kit (Zymo Research) in combination with peqGOLD TriFast (PeqLab Biotechnologie ...
-
bioRxiv - Cancer Biology 2019Quote: Total RNA was isolated from cells using the Direct-zol RNA miniprep kit (R2060, Zymo Research), with subsequent quantification using Nanodrop (Thermo Fisher Scientific) ...
-
bioRxiv - Cancer Biology 2019Quote: ... genomic DNA (gDNA) was isolated from cells using Quick-DNA Miniprep Kit (11-317AC, Zymo Research). 1.5-4.5 µg of gDNA from each cell line was digested with RsaI and HinfI ...
-
bioRxiv - Cancer Biology 2019Quote: Genomic DNA (gDNA) was isolated from cells using Quick-DNA Miniprep Kit (11-317AC, Zymo Research). 20 μL PCR reactions were performed using 50 ng gDNA and Phusion High-Fidelity DNA Polymerase (F-530 ...
-
bioRxiv - Developmental Biology 2019Quote: DNA was extracted from single cell colonies using the ZR Duet DNA/RNA Miniprep Kit (Zymo). A 708 bp PCR product around the editing site of Satb2-272 was amplified using primers Satb2-seq-F ACTGGCCTGATCGTCTATCA and Satb2-seq-R GCCAGATCCTAGGTCTCTGT ...
-
bioRxiv - Immunology 2019Quote: RNA were isolated from purified CD4+ T cells using Direct-zol RNA Purification Kit (Zymo Research) and cDNA were generated using iScript Reverse Transcriptase (Bio-Rad) ...
-
bioRxiv - Microbiology 2021Quote: RNA was extracted from CaCo-2 cells using Direct-zol™ RNA Microprep (ZYMO cat: R2062), according to manufacturer’s instructions ...
-
bioRxiv - Microbiology 2021Quote: ... RNA was extract from Jurat cells using the Direct-zol RNA MiniPrep Plus kit (Zymo Research) and cDNA was prepared ...
-
bioRxiv - Cell Biology 2020Quote: RNA from cells isolated by FACS was extracted using a Trizol-based kit (Zymo Research, R2061) and reverse transcribed using SuperScriptIII (Invitrogen ...
-
bioRxiv - Genetics 2022Quote: Total RNA was extracted from frozen cell pellets using the ZR Fungal/Bacterial miniprep kit (Zymo), according to the manufacturer’s instructions ...
-
bioRxiv - Developmental Biology 2022Quote: Total RNA was extracted from cells or organoids using the Quick-RNA MicroPrep kit (Zymo Research). RNA was subjected to quantitative real-time PCR in accordance with the protocol provided by one-step SYBR green RT-PCR Kit (Cwbio) ...
-
bioRxiv - Biochemistry 2022Quote: ... DNA from pre-sort control and sorted cells was extracted with Microprep DNA kits (Zymo Research) and triple-eluted with water ...
-
bioRxiv - Systems Biology 2022Quote: ... The pelleted cells were thawed and individually resuspended in 400 μl of RNA binding buffer (Zymo), then transferred to 2 ml screw cap tubes containing zirconia beads ...
-
bioRxiv - Microbiology 2020Quote: ... DNA from matched aliquots of CT cells using Quick-DNA Miniprep with Proteinase K (Zymo Research). As a control ...
-
bioRxiv - Microbiology 2021Quote: ... gallinae tissue lysates and host cells depleted using host depletion solution (Zymo Research, Irvine, CA, USA). Briefly ...
-
bioRxiv - Genomics 2022Quote: ... Genomic DNAs from CRISPR edited cells were extracted using Quick-DNA Microprep kit (Zymo Research, D3020). PCR primers were designed to amplify ~1000 bp amplicons from 100-200bp upstream of targeted deletions to 800-900bp downstream of target deletions ...
-
bioRxiv - Bioengineering 2021Quote: RNA was extracted from cells using a Direct-zol RNA MiniPrep Plus Kit (Zymo Research R2071). A Maxima First Strand cDNA Synthesis kit (Thermo Fisher K1641 ...
-
bioRxiv - Pharmacology and Toxicology 2021Quote: Total RNA from T84 cells was isolated using Direct-zol RNA MiniPrep kits (Zymo, Irvine, California). RNA was extracted initially using TRIzol (Invitrogen ...
-
bioRxiv - Cancer Biology 2020Quote: ... Cells were lysed and total RNA was extracted using Direct-zol RNA Miniprep plus (Zymo Research). Libraries were constructed using the non-strand-specific poly-A selection Illumina TruSeq kit for 50bp paired-end reads ...
-
bioRxiv - Microbiology 2019Quote: ... RNA was purified from bacterial cells using the Quick-RNA™ Miniprep Plus Kit (Zymo Research). Duplicate samples were prepared from independent biological replicates for each condition/strain ...
-
bioRxiv - Cell Biology 2021Quote: ... The plasmid DNAs were transformed and amplified in Mix & Go Competent Cells-Strain HB 101 (Zymo Research ...
-
bioRxiv - Systems Biology 2021Quote: ... RNA extraction of the isolated cells was performed with a Quick-RNA MiniPrep Kit by Zymo according to manufacturer’s instructions.
-
bioRxiv - Molecular Biology 2021Quote: RNA was extracted from HEK293 and CDK9as cells using a Quick-RNA Miniprep kit (Zymo Research) according to the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2021Quote: ... cells were lysed in Trizol (Thermo) followed by RNA purification with Direct-Zol Micro kit (Zymo). 5’ RACE products were generated with Template Switching RT Enzyme Mix (New England Biolabs ...
-
bioRxiv - Genetics 2019Quote: DNA was extracted from 35-50uL of packed red blood cells using Quick DNA Kit (Zymo). Libraries were prepared with ¼ reaction volumes of the KAPA HyperPlus DNA Library Kit and 20-50ng of extracted DNA according to manufacturer directions with slight modifications ...
-
bioRxiv - Immunology 2021Quote: ... plasmid DNA was transformed into yeast cells using frozen-EZ Yeast Transformation II kit (Zymo T2001). Briefly ...
-
bioRxiv - Bioengineering 2022Quote: ... DNA was extracted from the cell pellets using the ZymoBIOMICS DNA Miniprep kit (Zymo Research, Germany) with cell disruption within 20 min ...
-
bioRxiv - Cancer Biology 2022Quote: Genomic DNA was isolated from cells using the Zymo Research Quick-DNA Miniprep kit (Zymo Research). Adherent cells were washed once with 1X PBS and then lysed by adding ∼1 mL Genomic Lysis Buffer with 0.5% β-mercaptoethanol ...
-
bioRxiv - Biochemistry 2022Quote: ... and the cells were lysed lysed via bead beating on a Disruptor Genie® (Zymo Research) cell disruption device (2X ...
-
bioRxiv - Cancer Biology 2022Quote: RNA was extracted from one million cells using Direct-zol RNA Miniprep Kit (Zymo Research, 11331). Complementary DNA was synthesized using SuperScript™ First-Strand Synthesis system (Thermo Fisher Scientific ...
-
bioRxiv - Microbiology 2022Quote: Genomic DNA from vaginal cell pellets and the ZymoBIOMICS Microbial Community Standard (Zymo Research, Irvine, CA) was cleaned and concentrated with either sparQ PureMag beads (QuantaBio ...
-
bioRxiv - Physiology 2022Quote: Total RNA from tissues or cells was extracted using Direct-zol RNA MiniPrep kit (ZYMO Research). cDNA was obtained using High-Capacity cDNA Reverse Transcription Kit (Thermo Fisher) ...
-
bioRxiv - Cell Biology 2023Quote: Total RNA was purified from SV589 cells using the Direct-zol RNA miniprep kit (Zymo Research). poly(A ...
-
bioRxiv - Cell Biology 2023Quote: ... Total RNA was extracted from cells using the Quick RNA Mini-Prep extraction Kit (Zymo Research). Equal amounts of RNA were used to synthesize cDNA (BioRad) ...
-
bioRxiv - Biochemistry 2023Quote: ... Cells were then lysed and total RNA was extracted using Direct-zol RNA extraction kit (Zymo) following manufacturer protocols ...
-
bioRxiv - Biochemistry 2023Quote: ... cells were collected by centrifugation and RNA was extracted via Quick-RNA Miniprep Kit (Zymo Research) and complementary DNA (cDNA ...
-
bioRxiv - Molecular Biology 2023Quote: Plasmid DNA from yeast cell pellets was isolated using YeaStar Genomic DNA Kit (Zymo Research, D2002) per manufacturer’s instructions ...