Labshake search
Citations for Zymo Research :
401 - 450 of 1068 citations for 5 2 Chloronicotinoyl 2 furoic acid since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Molecular Biology 2024Quote: ... DNA was subsequently purified using Clean and Concentrated-5 DNA columns (Zymo). Sequencing libraries were prepared using NEBNext Ultra II DNA Library Prep Kit – DNA repair ...
-
bioRxiv - Molecular Biology 2024Quote: ... RNA was purified using an RNA Clean & Concentrator-5 kit (Zymo Research) according to the manufacturer’s protocol ...
-
bioRxiv - Molecular Biology 2024Quote: ... and repurified using a DNA Clean and Concentrator-5 Kit (Zymo #D4004). Next ...
-
bioRxiv - Molecular Biology 2024Quote: ... DNA was subsequently purified using Clean and Concentrated-5 DNA columns (Zymo).
-
bioRxiv - Molecular Biology 2024Quote: ... RNA was purified using an RNA Clean & Concentrator-5 kit (Zymo Research) according to the manufacturer’s protocol ...
-
bioRxiv - Microbiology 2024Quote: ... and RNA Clean and Concentrator-5 Kit (Zymo Research, catalogue number: R1013), respectively ...
-
bioRxiv - Biochemistry 2024Quote: ... and subsequently concentrated using a RNA Clean and Concentrator-5 kit (Zymo). RNA was then size-selected by running a 15% TBE-Urea gel and extracting fragments between 28 and 40 nt in length ...
-
bioRxiv - Molecular Biology 2024Quote: ... RNA was purified with an RNA Clean & Concentrator-5 kit (Zymo Research) according to the manufacturer’s protocol ...
-
bioRxiv - Molecular Biology 2024Quote: ... RNA was purified using an RNA Clean & Concentrator-5 kit (Zymo Research) according to the manufacturer’s protocol ...
-
bioRxiv - Microbiology 2024Quote: ... ZymoPURE II Plasmid Midiprep and DNA Clean & Concentrator-5 were from Zymo Research (Irvine ...
-
bioRxiv - Molecular Biology 2024Quote: ... RNA was extracted using the RNA Clean and Concentrator-5 kit (Zymo) following the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2024Quote: ... HypC4III digestion of PCR purified perR (Zymo DNA Clean and Concentrator-5) confirmed 630 perR integration since this restriction enzyme digests 630 perR but is unable to recognize that cut site in 630Δerm due to the point mutation (Figure S4) ...
-
bioRxiv - Genomics 2024Quote: ... DNA was isolated using the DNA Clean & Concentrator-5 kit (Zymo #D4013) and eluted in 11.5uL of 10mM Tris-HCl ...
-
bioRxiv - Neuroscience 2024Quote: ... and cleaned using the DNA Clean & Concentrator™-5 Kit (ZYMO Research). Libraries for the UFM 1 samples were prepared with the TruSeq Stranded Total RNA (Illumina ...
-
bioRxiv - Plant Biology 2024Quote: ... The cNDA was purified with the Clean&Concentrate-5 kit (Zymo Research), and eluted in 20 µL 10 mM Tris ...
-
bioRxiv - Neuroscience 2024Quote: ... RNA was extracted using the RNA clean & concentrator-5 kit (Zymo Research) according to the manufacturer’s instructions.
-
bioRxiv - Genomics 2024Quote: ... DNA was cleaned by DNA clean and concentrator-5 kit (Zymo, D4014) and sheared by Diagenode Biorupter Pico (EZ mode ...
-
bioRxiv - Genomics 2024Quote: ... End-repaired RNA was purified using RNA Clean & Concentrator-5 columns (Zymo). Illumina libraries were then prepared using the NEBNext® Multiplex Small RNA Library Prep Set for Illumina® kit (New England Biolabs ...
-
bioRxiv - Cancer Biology 2024Quote: ... and DNA was purified with DNA Clean & Concentrator-5 kit (ZYMO Research). For H3K27ac ChIP in P300 ...
-
bioRxiv - Bioengineering 2024Quote: ... The reaction was then cleaned using DNA Clean & Concentrator-5 (Zymo, D4013) and eluted in 6 μL H2O ...
-
bioRxiv - Cell Biology 2024Quote: ... 30 minutes and purified by RNA Clean&Concentrator-5 (Zymo Research, R1014). cDNA libraries (100 ng RNA ...
-
bioRxiv - Bioengineering 2024Quote: ... The extended barcode was cleaned with DNA Clean & Concentrator-5 (Zymo, D4013) and eluted in 20 μL H2O ...
-
bioRxiv - Bioengineering 2024Quote: ... The reaction was then cleaned using DNA Clean & Concentrator-5 (Zymo, D4013) and eluted in 6 μL H2O ...
-
bioRxiv - Bioengineering 2024Quote: ... The digested barcode was cleaned with DNA Clean & Concentrator-5 (Zymo, D4013) and diluted to 2 ng/μL ...
-
bioRxiv - Genetics 2024Quote: ... and then purified with the RNA Clean & Concentrator-5 kit (Zymo Research). We quantified the purified samples with the Qubit RNA Broad Range Assay Kit (Invitrogen) ...
-
bioRxiv - Microbiology 2020Quote: The double stranded deoxyribonucleic acids (dsDNA) was extracted from the duplicate sludge samples using ZR soil microbe DNA kit (Zymo Research, CA., USA), according to manufacturers instructions ...
-
bioRxiv - Microbiology 2020Quote: ... the nucleic acids were resuspended in DEPC-treated nuclease-free water purified with the OneStep PCR Inhibitor Removal Kit (Zymo Research, Irvine, USA), then split into a fraction for DNA and one for RNA ...
-
bioRxiv - Microbiology 2020Quote: ... The YAC DNA was extracted using spin column-based nucleic acid purification (ZR BAC DNA Miniprep Kit, ref. D4049, Zymo Research, Irvine, CA). The YAC containing viral cDNA was transformed into E ...
-
bioRxiv - Genetics 2021Quote: ... We purified reactions using Zymo DNA Clean and Concentrator-5 kit (Zymo D4013) following manufacturer protocols and eluted with 10.5μL water to recover 10μL ...
-
bioRxiv - Molecular Biology 2021Quote: ... and RNA was selectively recovered with RNA clean and concentrator-5 (Zymo Research). RNA fragments were then 5’ phosphorylated with T4 polynucleotide kinase in T4 PNK buffer ...
-
bioRxiv - Developmental Biology 2020Quote: ... and further purified using the RNA Clean & Concentrator-5 kit (Zymo Research, R1013). Samples were treated 30 minutes with TURBO DNase per manufacturer protocol (Thermo Fisher ...
-
bioRxiv - Molecular Biology 2021Quote: ... DNA was purified with a DNA Clean & Concentrator-5 Kit (Zymo Research, D4013) according to the manufacturer’s protocol ...
-
bioRxiv - Molecular Biology 2020Quote: ... The RNA purification was performed using RNA Clean & Concentrator-5 kit (Zymo Research) as described by manufacturer ...
-
bioRxiv - Genomics 2020Quote: ... gDNA fragments were purified using the DNA Clean & Concentrator-5 kit (Zymo Research).
-
bioRxiv - Genetics 2021Quote: ... RNA samples were purified with an RNA Clean & Concentrator-5 (Zymo Research, R1015), and cDNA generated as described ...
-
bioRxiv - Genetics 2020Quote: ... Tagged DNA was purified with the DNA Clean & Concentrator-5 kit (Zymo Research) eluting with 14 µl EB buffer (Qiagen) ...
-
bioRxiv - Cancer Biology 2020Quote: ... The cDNA products were concentrated using cDNA Clean & Concentrator-5 Kit (Zymo Research) followed bead cleanup using 0.6X AMPure XP Beads (Beckman Coulter ...
-
bioRxiv - Synthetic Biology 2021Quote: ... These libraries were purified using the DNA Clean & Concentrator™-5 kit (Zymo) and eluted in water ...
-
bioRxiv - Synthetic Biology 2021Quote: ... The resulting crRNA was purified using RNA Clean & ConcentratorTM-5 kit (Zymo Research), and subsequently quantified using a NanoDrop 2000 spectrophotometer (Thermo Fisher Scientific) ...
-
bioRxiv - Microbiology 2020Quote: ... RNA was cleaned using the Zymo Clean and Concentrate 5 column (Zymo Research) and eluted in 2x 20 μL (final 40 μL) ...
-
bioRxiv - Genomics 2021Quote: ... Reactions were pooled and purified by DNA Clean and Concentrator 5 (Zymo Research). pLCv2-opti-stuffer-mCherry was digested as described 41 ...
-
bioRxiv - Neuroscience 2022Quote: ... the product was purified with the DNA Clean & Concentrator-5 Kit (Zymo Research). 20 μl tagmented DNA was PCR amplified with NEBNext High-Fidelity PCR Master mix and forward and reverse UDI primers ...
-
bioRxiv - Developmental Biology 2022Quote: Linearized plasmid DNA was cleaned using DNA Clean & concentrator-5 (Zymo Research #D4014). In situ hybridization was completed according to a standard protocol (Cunningham and Monk ...
-
bioRxiv - Molecular Biology 2022Quote: ... The product was cleaned up using RNA Clean & Concentrator-5 kit (ZYMO, R1013) and added into 20 μl of reverse transcription and strand-switching reaction containing 100 nM custom primer (5’ - phos/ ACTTGCCTGTCGCTCTATCTTCATTGATGGTGCCTACAG - 3’) ...
-
bioRxiv - Molecular Biology 2022Quote: ... rRNA-depleted RNA was purified by RNA Clean & Concentrator-5 kit (ZYMO, R1013) and then ligated to 50 pmol 3’ adapter (5’-rAppCTGTAGGCACCATCAAT - NH2-3’ ...
-
bioRxiv - Microbiology 2022Quote: ... The DMS-modified RNA was purified using RNA Clean and ConcentratorTM-5 (Zymo) and eluted in 10µl water.
-
bioRxiv - Genetics 2022Quote: ... followed by another round of clean up (Zymo RNA Clean and Concentrator 5). The final sequence of the spike-in mRNA is ...
-
bioRxiv - Bioengineering 2022Quote: ... DNA products were purified using the DNA Clean & Concentrator-5 Kit (Zymo Research). All purified PCR products were visually checked for expected size via 1% agarose gel electrophoresis and assessed for purity and yield via Nanodrop (Thermo Fisher Scientific).
-
bioRxiv - Microbiology 2020Quote: ... and subsequently purified using the RNA Clean and Concentrate −5 kit (Zymo Research). RNA was then prepped for deep-sequencing using the TruSeq Stranded mRNA Library Preparation Kit (Illumina ...
-
bioRxiv - Plant Biology 2021Quote: ... The remaining RNA was recovered with RNA Clean & Concentrator-5 (Zymo Research, USA). RNA fragments ranging from 200–1000 nucleotides in size were validated on an Agilent 2100 Bioanalyzer.