Labshake search
Citations for Zymo Research :
351 - 400 of 6111 citations for NGS ChIP Seq kit since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2023Quote: ... A total of 500 ng of genomic DNA from cells in co-cultures were bisulfite-treated using the ZymoResearch EZ DNA Methylation kit (Zymo Research Corp, Irvine, CA, USA). The Infinium HD Methylation Assay (bisulfite modification ...
-
bioRxiv - Neuroscience 2021Quote: ... then re-cleaned and concentrated to >200 ng/ml (Zymo Research ...
-
bioRxiv - Genomics 2023Quote: ... IPs and inputs (diluted to 200ul in elution buffer) were cleaned up with Zymo ChIP DNA columns (Zymo Research, D5205). Libraries were prepared with NuGEN Ovation V2 DNA-Seq Library Preparation Kit ...
-
bioRxiv - Plant Biology 2021Quote: ... The reaction was then cleaned up using Zymo ChIP DNA Clean & Concentrator following the manufacturers’ instructions (Zymo Research; Irvine, CA, USA). The resulting PCR reaction was then cloned into pGEM T-Vector system and selected for using the XGal/IPTG system (Promega ...
-
bioRxiv - Biochemistry 2019Quote: ... Elutions were subsequently de-crosslinked overnight at 65 °C and DNA was purified using ChIP DNA Clean and Concentrator (Zymo Research) and DNA was used for qPCR ...
-
bioRxiv - Molecular Biology 2020Quote: ... Samples were treated with RNase for 1 hour and proteinase K for 1 hour before ChIP DNA Clean & Concentrator (Zymo Research) to extract the DNA.
-
bioRxiv - Genomics 2021Quote: ... Libraries were size selected using TBE gels for 300-500 bp and DNA eluted using gel diffusion buffer and purified using ChIP DNA Clean & Concentrator (Zymo Research). Samples were quantified by Qubit dsDNA HS Assay Kit (Thermo Fisher Scientific ...
-
bioRxiv - Genetics 2023Quote: ... Bead-bound cells were placed on a magnetic stand and DNA-containing supernatant was cleaned using ChIP DNA Clean & Concentrator (Zymo Research, D5201). Transposed libraries were amplified in 50 μl PCRs (25 µl NEBNext HiFi 2× PCR master mix ...
-
bioRxiv - Microbiology 2020Quote: ... A total of 150 ng of the ZR small RNA ladder (Zymo Research) and 120 pmol of a homemade mix of synthetic RNA (MX with 31,29 ...
-
bioRxiv - Molecular Biology 2021Quote: ... 10 ng firefly luciferaseencoding purified T7 RNA (RNA Clean and Concentrator, Zymo research), the indicated amount of gapmers ...
-
bioRxiv - Plant Biology 2021Quote: ... Then 150 ng gDNA from each F2 plant was fragmented using dsDNA Shearase (Zymo Research) and used to generate one sequencing library per plant ...
-
bioRxiv - Molecular Biology 2020Quote: ... 500 ng of genomic DNA was incubated with 5 U of DNA Degradase Plus (Zymo Research) at 37°C for 3 h ...
-
bioRxiv - Genetics 2023Quote: 500 ng of DNA isolated from the left lungs was treated with sodium bisulfite (Zymo Research) to generate bisulfite-converted DNA (bcDNA) ...
-
bioRxiv - Genomics 2023Quote: ... Any sample under 20 ng/μl was concentrated using the Genomic DNA Concentrator Columns (Zymo Research), eluted in 12 μl water ...
-
bioRxiv - Molecular Biology 2023Quote: A total of 200 ng of genomic DNA was digested using 5U of DNA Degradase Plus (Zymo Research, E2020) overnight at 37ºC and the base content quantified using a nanoHPLC and Q Exactive mass spectrometer (as described in 85).
-
bioRxiv - Bioengineering 2023Quote: ... Triplicate RNA samples from each condition were diluted to 20 ng/μl with DNase/RNase-Free Water (ZYMO RESEARCH). 15μl RNA solution of each replicate were sent to the UCLA Center for Systems Biomedicine for RNA expression assay with the Nanostring™ nCounter ...
-
bioRxiv - Developmental Biology 2022Quote: ... The DNA digestion efficiency was monitored by using 100 ng 5-methylcytosine and 5-hydroxymethylcytosine DNA standard sets (Zymo Research) in parallel under identical conditions ...
-
bioRxiv - Molecular Biology 2019Quote: 100 ng of bisulphite-converted DNA was used as template for the PCR using the ZymoTaq DNA polymerase (Zymo Research). The reaction was carried out in a total volume of 40 µl in the reaction buffer provided by the manufacturer supplemented with of 1 mM dNTPs ...
-
bioRxiv - Microbiology 2022Quote: ... Gel extraction kit and DNA purification kit were from Zymo Research ...
-
bioRxiv - Genetics 2021Quote: DNA samples ranging from 500 ng-2 μg were digested to free nucleosides using 5-15 U of DNA Degradase Plus (Zymo Research) in 25 μl reactions incubated for 2 hrs at 37 °C ...
-
bioRxiv - Genetics 2022Quote: ... Total RNA (500 ng) was extracted from frozen whole larvae and larval fillets with Direct-zol™ RNA MicroPrep (Zymo Research) according to manufacturer’s protocol ...
-
bioRxiv - Cell Biology 2019Quote: RNA was isolated using a commercial kit (RNAmicro kit, Zymo Research), according to the manufacturer’s instructions ...
-
bioRxiv - Genomics 2023Quote: ... Plasmid is extracted from the bacterial culture using a 96-well mini-prep kit (Zymo kit, Zippy 96 plasmid kit). All clones are sequenced by Sanger sequencing at the site of the barcode using primer ACTTGTGTAGCGCCAAGTGC ...
-
bioRxiv - Genetics 2019Quote: ... and gel extraction kit (Zymoclean Gel DNA Recovery Kit) were from Zymo Research ...
-
bioRxiv - Bioengineering 2022Quote: ... using a commercial kit (ZymoPURE II Plasmid Maxiprep Kit; Zymo Research Corp). HEK293Ta cells (Genecopoeia ...
-
bioRxiv - Biophysics 2021Quote: ... Plasmids used for nucleofections were purified by Zymo midiprep kit (Zymo D4200) and concentrations were quantified by absorption at 260 nm ...
-
bioRxiv - Synthetic Biology 2023Quote: ... coli Transformation Kit (Zymo).
-
bioRxiv - Biophysics 2023Quote: ... Plasmids were purified by Zymo midiprep kit (Zymo D4200) and all cloning was confirmed by Sanger sequencing ...
-
bioRxiv - Microbiology 2023Quote: ... coli Transformation Kit (Zymo).
-
bioRxiv - Molecular Biology 2022Quote: ... ZymoPure Plasmid Midiprep kit and RNA Clean & Concentrator kit were purchased from Zymo Research ...
-
bioRxiv - Microbiology 2023Quote: ... RNA was isolated using a commercial kit (DirectZol RNA Miniprep kit, Zymo Research) following manufacturer instructions ...
-
bioRxiv - Biochemistry 2023Quote: ... ZymoPURE II Midiprep Kit or the ZymoPURE II Maxiprep Kit (all Zymo Research).
-
bioRxiv - Immunology 2023Quote: ... the RNeasy Plus kit (specifically, the Quick RNA miniprep plus kit, Zymo, USA) was utilized and RNA was quantitated with Qubit RNA HS (High Sensitivity ...
-
bioRxiv - Molecular Biology 2023Quote: ... DNA and RNA were extracted using commercial kits: Quick-DNA-fungal/bacterial MiniPrep™ kit (ZymoResearch) was used for DNA and Quick-RNA-fungal/bacterial MiniPrep™ kit (Zymo Research) was used for RNA ...
-
bioRxiv - Synthetic Biology 2022Quote: ... coli using GeneJet plasmid miniprep kit (ThermoScientific) or ZymoPURE plasmid midiprep kit (Zymo Research). Sequences of all plasmids were confirmed using Sanger sequencing performed by Eurofins Genomics ...
-
bioRxiv - Microbiology 2023Quote: ... coli using GeneJet plasmid miniprep kit (ThermoScientific) or ZymoPURE plasmid midiprep kit (Zymo Research). Sequences of all plasmids were confirmed using Sanger sequencing performed by Eurofins Genomics ...
-
bioRxiv - Microbiology 2024Quote: ... The three PCR fragments were purified (Zymo DNA Clean and Concentrator kit: ‘Zymo kit’) and used in a 1:1:1 molar ratio Golden Gate assembly reaction with BsaI (NEB ...
-
bioRxiv - Microbiology 2021Quote: ... coli transformation kit (Zymo Research) or standard electro-transformation protocols ...
-
bioRxiv - Neuroscience 2020Quote: ... or MiniPrep Kit (R2052, Zymo Research ...
-
bioRxiv - Synthetic Biology 2020Quote: ... coli Transformation Kit (Zymo Research).
-
bioRxiv - Synthetic Biology 2021Quote: ... coli Transformation Kit from Zymo Research (Irvine ...
-
bioRxiv - Genomics 2021Quote: ... the RCC kit (Zymo Research).
-
bioRxiv - Developmental Biology 2020Quote: ... or Quick-RNA kit (Zymo). Reverse transcription was carried out by using the High-Capacity RNA-to-cDNA Kit (ThermoFisher) ...
-
bioRxiv - Synthetic Biology 2023Quote: ... coli Transformation Kit (Zymo Research). For each transformation ...
-
bioRxiv - Developmental Biology 2023Quote: ... and RNA purification kit (Zymo). cDNA was generated using Maxima First Strand cDNA synthesis kit (Thermo Fisher Scientific) ...
-
bioRxiv - Genetics 2023Quote: ... ZymoPure Midiprep Kit (Zymo Research) was used to prepare donor constructs for embryo injection ...
-
bioRxiv - Microbiology 2024Quote: ... Correct amplicons were isolated by Zymo PCR purification kit (Zymo Research). The PCR products were cloned into a PCR linearized pEcgRNA-guide plasmid to make the pEcgRNA-guide-RT plasmid using In-fusion® HD-cloning kit (Takara Bio ...
-
bioRxiv - Synthetic Biology 2024Quote: ... coli Transformation Kit (Zymo Research), and transformations were carried out using 50 ng of ligation product or plasmid ...
-
bioRxiv - Cancer Biology 2024Quote: ... coli Transformation Kit (Zymo Research). Plasmids were prepared following standard protocols ...
-
bioRxiv - Biochemistry 2021Quote: ... Zyppy™ Plasmid Miniprep kit and DNA Clean & Concentrator™ kit were purchased from Zymo Research ...