Labshake search
Citations for Zymo Research :
3801 - 3850 of 6537 citations for Rat Wide range C Peptide CP CLIA Kit since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Plant Biology 2020Quote: ... total RNA was extracted from bacterial lysates using Direct-zol RNA MiniPrep Plus kit (Zymo Research), treated with DNase I (Zymo Research ...
-
bioRxiv - Molecular Biology 2019Quote: ... Total RNA was extracted from transfected cells and media with Direct-zol RNA kit (Zymo Research), and DNase I in-column digestion was conducted to remove plasmids ...
-
bioRxiv - Genetics 2019Quote: ... RNA was isolated from plant tissue using the Zymopure RNA Extraction kit (Zymo Research, Irvine, CA), and reverse transcribed with the ThermoFischer Reverse Transcription kit ...
-
bioRxiv - Neuroscience 2019Quote: Total RNA was extracted from cell lysates using Direct-zol RNA Mini Prep kit (Zymo Research) in combination with peqGOLD TriFast (PeqLab Biotechnologie ...
-
bioRxiv - Cancer Biology 2019Quote: Total RNA was isolated from cells using the Direct-zol RNA miniprep kit (R2060, Zymo Research), with subsequent quantification using Nanodrop (Thermo Fisher Scientific) ...
-
bioRxiv - Plant Biology 2019Quote: ... RNA was extracted from each sample using the Direct-Zol™ RNA Miniprep Kit (Zymo Research) according to the kit instructions ...
-
Parallelized engineering of mutational models using piggyBac transposon delivery of CRISPR librariesbioRxiv - Bioengineering 2020Quote: ... Endotoxin-free plasmid library DNA was prepared using the ZymoPURE II Plasmid Maxiprep Kit (Zymo Research). To clone the library of gRNA pairs ...
-
bioRxiv - Molecular Biology 2019Quote: ... RNA was extracted from the resulting lysate using the Direct-zol RNA Miniprep Kit (R2070, Zymo) following manufacturer’s instructions ...
-
bioRxiv - Microbiology 2019Quote: ... Total RNA (including symbiont RNA) was then isolated using the Direct-zol RNA Kit (Zymo Research), and the isolated RNA was treated with DNase I (Qiagen ...
-
bioRxiv - Genetics 2019Quote: ... 500 ng genomic DNA was processed using an EZ DNA Methylation-Gold Kit™ (ZYMO Research), in accordance with the manufacturer’s instructions ...
-
bioRxiv - Cancer Biology 2019Quote: ... genomic DNA (gDNA) was isolated from cells using Quick-DNA Miniprep Kit (11-317AC, Zymo Research). 1.5-4.5 µg of gDNA from each cell line was digested with RsaI and HinfI ...
-
bioRxiv - Cancer Biology 2019Quote: Genomic DNA (gDNA) was isolated from cells using Quick-DNA Miniprep Kit (11-317AC, Zymo Research). 20 μL PCR reactions were performed using 50 ng gDNA and Phusion High-Fidelity DNA Polymerase (F-530 ...
-
bioRxiv - Genetics 2019Quote: ... and then the RNA was extracted using TRIzol and Direct-zol RNA miniprep kit (Zymo Research).
-
bioRxiv - Developmental Biology 2019Quote: DNA was extracted from single cell colonies using the ZR Duet DNA/RNA Miniprep Kit (Zymo). A 708 bp PCR product around the editing site of Satb2-272 was amplified using primers Satb2-seq-F ACTGGCCTGATCGTCTATCA and Satb2-seq-R GCCAGATCCTAGGTCTCTGT ...
-
bioRxiv - Microbiology 2020Quote: ... pJMC158 DNA was isolated from a clone using the ZR Plasmid Miniprep Classic Kit (Zymo Research), sequence confirmed ...
-
bioRxiv - Genomics 2020Quote: ... and total RNA was isolated using the Diret-zol RNA mini-prep kit (Zymo Research R2051). Sequencing libraries were prepared using the QuantSeq 3’-mRNA Seq Library Prep Kit for Illumina (Lexogen ...
-
bioRxiv - Pathology 2019Quote: ... and further purified and concentrated using DNA Clean and Concentrator Kit (Zymo Research, Irvine, CA, USA) according to the manufacturer’s protocol ...
-
bioRxiv - Immunology 2019Quote: RNA were isolated from purified CD4+ T cells using Direct-zol RNA Purification Kit (Zymo Research) and cDNA were generated using iScript Reverse Transcriptase (Bio-Rad) ...
-
bioRxiv - Genetics 2019Quote: ... PCR products were column purified using the ZR-96 DNA Clean-up Kit (Zymo Research, D4018) according to the manufacturer’s protocol ...
-
bioRxiv - Genetics 2019Quote: ... and RNA was extracted using the Direct-Zol RNA Extraction Kit (Zymo research, Irvine, CA, USA) following the manufacturer's instructions ...
-
bioRxiv - Bioengineering 2019Quote: ... Total RNA was purified using the Direct-Zol RNA miniprep kit (Zymo Research, Irvine, CA, USA) as described in the protocol ...
-
bioRxiv - Epidemiology 2019Quote: ... DNA was bisulphite-converted using the Zymo EZ DNA Methylation™ kit (Zymo, Irvine, CA, USA). Genome-wide methylation data were generated using the Infinium MethylationEPIC BeadChips (EPIC array ...
-
bioRxiv - Genomics 2020Quote: ... DNA conversion was carried out using the EZ DNA Methylation-Gold Kit (Zymo Research, CA, USA) following the manufacturer’s instructions ...
-
bioRxiv - Genetics 2021Quote: ... in vitro synthesized mRNA was purified with the RNA Clean and Concentrator Kit RCC (Zymo, R1013). 12.5 pg Cre or 15 pg Dre mRNA was injected into 1 cell stage embryos to promote recombination mediated inversion of the UFlip cassette at lox or rox sites ...
-
bioRxiv - Genetics 2021Quote: ... RNA from the monosome fraction was extracted using TRIzol LS and a Direct-zol kit (Zymo). The RNA was loaded on a Novex 15% TBE-Urea gel (Life Technologies ...
-
bioRxiv - Genetics 2020Quote: ... Total RNA was extracted from the supernatant using the Quick-RNA Plant Miniprep Kit (Zymo Research) with the inclusion of in-column DNAse I treatment ...
-
bioRxiv - Developmental Biology 2020Quote: ... DNA was bisulfite converted using an EZ DNA Methylation-Lightning™ Kit (Zymo Research Corporation, D5030T). PCR was performed to amplify the ELF5 and C19MC gene regions ...
-
bioRxiv - Genomics 2020Quote: ... Extracted DNA was purified with Genomic DNA Clean & Concentrator −10 kit (Zymo Research, Irvine, CA, USA). A total of 17.9 μg of high-molecular weight DNA was used for PacBio sequencing ...
-
bioRxiv - Microbiology 2021Quote: ... The RNA samples were afterward purified using the RNA Clean & Concentrator™ −5 kit (ZYMO RESEARCH) following the manufacturer’s instructions ...
-
bioRxiv - Neuroscience 2021Quote: Total RNA was extracted from thirty male adult heads using the RNA extraction kit (Zymo Research). After removal of genomic DNA using the DNA-free kit (AMBION ...
-
bioRxiv - Microbiology 2021Quote: DNA extraction was performed using a ZymoBIOMICS® -96 MagBead DNA kit (Zymo Research, Irvine, CA) or ZymoBIOMICS® DNA Miniprep kit (Zymo Research ...
-
bioRxiv - Cell Biology 2020Quote: ... DNase-treated samples were then further purified and concentrated using an RNA-cleanup kit (Zymo Research), and cDNA was obtained using SuperScript III first-strand synthesis (Invitrogen) ...
-
bioRxiv - Microbiology 2021Quote: Total RNA was extracted using the Quick-RNA™Fungal/Bacterial Miniprep kit (Zymo Research R2010) according to the manufacturer’s instructions ...
-
Safety and efficacy of C9ORF72-repeat RNA nuclear export inhibition in amyotrophic lateral sclerosisbioRxiv - Systems Biology 2021Quote: ... Fractionated extracts were subjected to RNA extraction using Direct-zol™ RNA microprep kits (Zymo Research) following the manufacturer’s protocol ...
-
bioRxiv - Bioengineering 2020Quote: ... The PCR product was purified using a Zymo DNA Clean and Concentrator Kit (Zymo Research D4014). Sequences for these primers and thermocycling conditions are given in Figure S7)
-
bioRxiv - Biochemistry 2020Quote: Total RNA was isolated from liver tissues using the Direct-zol RNA extraction kit from Zymo Research (Irvine ...
-
bioRxiv - Neuroscience 2021Quote: ... Total RNA was isolated from spinal cord tissue using Direct-zol RNA MiniPrep Kit (Zymo Research) following the manufacturer protocol ...
-
bioRxiv - Neuroscience 2021Quote: ... The bisulfite conversion of genomic DNA was performed using the EZ Methylation Kit (Zymo Research, D5002), following the manufacturer’s instructions ...
-
bioRxiv - Plant Biology 2021Quote: ... The ligation products were used for bisulfite conversion using an EZ DNA Methylation-Gold kit (ZYMO). The different-sized fragments were separated and collected by electrophoresis on 2% Tris acetate EDTA (TAE ...
-
bioRxiv - Plant Biology 2021Quote: ... These were transformed into appropriate yeast strains using Frozen-EZ yeast Transformation Kit II (Zymo Research). AtPIP-GFP were used to evaluate heterologous AtPIP production ...
-
bioRxiv - Synthetic Biology 2021Quote: ... The gel slice was then purified using a ZR small-RNA PAGE Recovery kit (Zymo Research) according to the manufacturer’s instructions.
-
bioRxiv - Plant Biology 2020Quote: ... RNA was purified using Direct-Zol™ RNA mini-prep kit (Zymo Research, Irvine, CA, USA) and any traces of genomic DNA contamination was removed using enzymatic DNase I treatment ...
-
bioRxiv - Plant Biology 2021Quote: ... Yeast transformation was performed using the Frozen-EZ yeast transformation II kit (Zymo Research, Irvine, CA) and selection of positive transformants was based on amino acid complementation ...
-
bioRxiv - Microbiology 2020Quote: ... Total genomic DNA was extracted using ZR Fungal/Bacterial DNA MiniPrep Kit (Zymo Research®, USA). Library preparation was performed by enzymatic fragmentation using Nextera DNA Library Prep kit (Illumina ...
-
bioRxiv - Plant Biology 2021Quote: ... Total RNA was extracted using Direct-zol™ RNA Miniprep Plus kit (Zymo Research, Freiburg, Germany) according to the manufacturer`s instructions ...
-
bioRxiv - Microbiology 2020Quote: RNA from Anabaena WT was isolated using the Direct-zol™ RNA MiniPrep Kit (Zymo Research) according to the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2021Quote: ... RNA was extract from Jurat cells using the Direct-zol RNA MiniPrep Plus kit (Zymo Research) and cDNA was prepared ...
-
bioRxiv - Microbiology 2021Quote: ... Viral RNAs were purified from the stock virus by using Quick-RNA viral kit (Zymo Research) and sent for RNA-seq for verification (University of Washington).
-
bioRxiv - Microbiology 2021Quote: ... kit before clean up and concentration using a Genomic DNA Clean & Concentrator-25 (Zymo Research, US) kit ...
-
bioRxiv - Genetics 2021Quote: ... in vitro synthesized mRNA was purified with the RNA Clean and Concentrator Kit RCC (Zymo, R1013).