Labshake search
Citations for Zymo Research :
3801 - 3850 of 6550 citations for Rat LIM Domain Kinase 2 LIMK2 ELISA Kit since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Genetics 2019Quote: ... and then the RNA was extracted using TRIzol and Direct-zol RNA miniprep kit (Zymo Research).
-
bioRxiv - Developmental Biology 2019Quote: DNA was extracted from single cell colonies using the ZR Duet DNA/RNA Miniprep Kit (Zymo). A 708 bp PCR product around the editing site of Satb2-272 was amplified using primers Satb2-seq-F ACTGGCCTGATCGTCTATCA and Satb2-seq-R GCCAGATCCTAGGTCTCTGT ...
-
bioRxiv - Microbiology 2020Quote: ... pJMC158 DNA was isolated from a clone using the ZR Plasmid Miniprep Classic Kit (Zymo Research), sequence confirmed ...
-
bioRxiv - Genomics 2020Quote: ... and total RNA was isolated using the Diret-zol RNA mini-prep kit (Zymo Research R2051). Sequencing libraries were prepared using the QuantSeq 3’-mRNA Seq Library Prep Kit for Illumina (Lexogen ...
-
bioRxiv - Pathology 2019Quote: ... and further purified and concentrated using DNA Clean and Concentrator Kit (Zymo Research, Irvine, CA, USA) according to the manufacturer’s protocol ...
-
bioRxiv - Immunology 2019Quote: RNA were isolated from purified CD4+ T cells using Direct-zol RNA Purification Kit (Zymo Research) and cDNA were generated using iScript Reverse Transcriptase (Bio-Rad) ...
-
bioRxiv - Genetics 2019Quote: ... PCR products were column purified using the ZR-96 DNA Clean-up Kit (Zymo Research, D4018) according to the manufacturer’s protocol ...
-
bioRxiv - Genetics 2019Quote: ... and RNA was extracted using the Direct-Zol RNA Extraction Kit (Zymo research, Irvine, CA, USA) following the manufacturer's instructions ...
-
bioRxiv - Bioengineering 2019Quote: ... Total RNA was purified using the Direct-Zol RNA miniprep kit (Zymo Research, Irvine, CA, USA) as described in the protocol ...
-
bioRxiv - Epidemiology 2019Quote: ... DNA was bisulphite-converted using the Zymo EZ DNA Methylation™ kit (Zymo, Irvine, CA, USA). Genome-wide methylation data were generated using the Infinium MethylationEPIC BeadChips (EPIC array ...
-
bioRxiv - Genomics 2020Quote: ... DNA conversion was carried out using the EZ DNA Methylation-Gold Kit (Zymo Research, CA, USA) following the manufacturer’s instructions ...
-
bioRxiv - Genetics 2021Quote: ... in vitro synthesized mRNA was purified with the RNA Clean and Concentrator Kit RCC (Zymo, R1013). 12.5 pg Cre or 15 pg Dre mRNA was injected into 1 cell stage embryos to promote recombination mediated inversion of the UFlip cassette at lox or rox sites ...
-
bioRxiv - Genetics 2021Quote: ... RNA from the monosome fraction was extracted using TRIzol LS and a Direct-zol kit (Zymo). The RNA was loaded on a Novex 15% TBE-Urea gel (Life Technologies ...
-
bioRxiv - Genetics 2020Quote: ... Total RNA was extracted from the supernatant using the Quick-RNA Plant Miniprep Kit (Zymo Research) with the inclusion of in-column DNAse I treatment ...
-
bioRxiv - Developmental Biology 2020Quote: ... DNA was bisulfite converted using an EZ DNA Methylation-Lightning™ Kit (Zymo Research Corporation, D5030T). PCR was performed to amplify the ELF5 and C19MC gene regions ...
-
bioRxiv - Genomics 2020Quote: ... Extracted DNA was purified with Genomic DNA Clean & Concentrator −10 kit (Zymo Research, Irvine, CA, USA). A total of 17.9 μg of high-molecular weight DNA was used for PacBio sequencing ...
-
bioRxiv - Microbiology 2021Quote: ... The RNA samples were afterward purified using the RNA Clean & Concentrator™ −5 kit (ZYMO RESEARCH) following the manufacturer’s instructions ...
-
bioRxiv - Neuroscience 2021Quote: Total RNA was extracted from thirty male adult heads using the RNA extraction kit (Zymo Research). After removal of genomic DNA using the DNA-free kit (AMBION ...
-
bioRxiv - Microbiology 2021Quote: DNA extraction was performed using a ZymoBIOMICS® -96 MagBead DNA kit (Zymo Research, Irvine, CA) or ZymoBIOMICS® DNA Miniprep kit (Zymo Research ...
-
bioRxiv - Cell Biology 2020Quote: ... DNase-treated samples were then further purified and concentrated using an RNA-cleanup kit (Zymo Research), and cDNA was obtained using SuperScript III first-strand synthesis (Invitrogen) ...
-
bioRxiv - Microbiology 2021Quote: Total RNA was extracted using the Quick-RNA™Fungal/Bacterial Miniprep kit (Zymo Research R2010) according to the manufacturer’s instructions ...
-
Safety and efficacy of C9ORF72-repeat RNA nuclear export inhibition in amyotrophic lateral sclerosisbioRxiv - Systems Biology 2021Quote: ... Fractionated extracts were subjected to RNA extraction using Direct-zol™ RNA microprep kits (Zymo Research) following the manufacturer’s protocol ...
-
bioRxiv - Bioengineering 2020Quote: ... The PCR product was purified using a Zymo DNA Clean and Concentrator Kit (Zymo Research D4014). Sequences for these primers and thermocycling conditions are given in Figure S7)
-
bioRxiv - Biochemistry 2020Quote: Total RNA was isolated from liver tissues using the Direct-zol RNA extraction kit from Zymo Research (Irvine ...
-
bioRxiv - Neuroscience 2021Quote: ... Total RNA was isolated from spinal cord tissue using Direct-zol RNA MiniPrep Kit (Zymo Research) following the manufacturer protocol ...
-
bioRxiv - Neuroscience 2021Quote: ... The bisulfite conversion of genomic DNA was performed using the EZ Methylation Kit (Zymo Research, D5002), following the manufacturer’s instructions ...
-
bioRxiv - Plant Biology 2021Quote: ... The ligation products were used for bisulfite conversion using an EZ DNA Methylation-Gold kit (ZYMO). The different-sized fragments were separated and collected by electrophoresis on 2% Tris acetate EDTA (TAE ...
-
bioRxiv - Plant Biology 2021Quote: ... These were transformed into appropriate yeast strains using Frozen-EZ yeast Transformation Kit II (Zymo Research). AtPIP-GFP were used to evaluate heterologous AtPIP production ...
-
bioRxiv - Synthetic Biology 2021Quote: ... The gel slice was then purified using a ZR small-RNA PAGE Recovery kit (Zymo Research) according to the manufacturer’s instructions.
-
bioRxiv - Plant Biology 2020Quote: ... RNA was purified using Direct-Zol™ RNA mini-prep kit (Zymo Research, Irvine, CA, USA) and any traces of genomic DNA contamination was removed using enzymatic DNase I treatment ...
-
bioRxiv - Plant Biology 2021Quote: ... Yeast transformation was performed using the Frozen-EZ yeast transformation II kit (Zymo Research, Irvine, CA) and selection of positive transformants was based on amino acid complementation ...
-
bioRxiv - Microbiology 2020Quote: ... Total genomic DNA was extracted using ZR Fungal/Bacterial DNA MiniPrep Kit (Zymo Research®, USA). Library preparation was performed by enzymatic fragmentation using Nextera DNA Library Prep kit (Illumina ...
-
bioRxiv - Plant Biology 2021Quote: ... Total RNA was extracted using Direct-zol™ RNA Miniprep Plus kit (Zymo Research, Freiburg, Germany) according to the manufacturer`s instructions ...
-
bioRxiv - Microbiology 2020Quote: RNA from Anabaena WT was isolated using the Direct-zol™ RNA MiniPrep Kit (Zymo Research) according to the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2021Quote: ... RNA was extract from Jurat cells using the Direct-zol RNA MiniPrep Plus kit (Zymo Research) and cDNA was prepared ...
-
bioRxiv - Microbiology 2021Quote: ... Viral RNAs were purified from the stock virus by using Quick-RNA viral kit (Zymo Research) and sent for RNA-seq for verification (University of Washington).
-
bioRxiv - Microbiology 2021Quote: ... kit before clean up and concentration using a Genomic DNA Clean & Concentrator-25 (Zymo Research, US) kit ...
-
bioRxiv - Genetics 2021Quote: ... in vitro synthesized mRNA was purified with the RNA Clean and Concentrator Kit RCC (Zymo, R1013).
-
bioRxiv - Genomics 2019Quote: ... We then purified DNA with Genomic DNA Clean Concentrator kit (Zymo Research, Irvine, CA, USA Research). Targeted DMRs were amplified from each of the purified deaminated DNA using custom designed primers (Supplemental Table 6).
-
bioRxiv - Microbiology 2021Quote: ... PCR products were purified with a Zymo DNA Clean & Concentrator kit (Cat no. D4034, Zymo Research) according to the manufacturer’s instructions ...
-
bioRxiv - Genetics 2021Quote: ... samples were bisulphite converted using the Zymo EZ DNA Methylation™ kit (Zymo, Irvine, CA, USA), and DNA methylation was measured using the Illumina Infinium HumanMethylation450 (HM450 ...
-
bioRxiv - Genomics 2021Quote: ... Bisulfite conversion of adaptor-ligated DNA was performed using EZ DNA Methylation-Gold Kit (Zymo Research). Library amplification (13 PCR cycles ...
-
bioRxiv - Genetics 2021Quote: ... Genomic DNA samples were treated with bisulfite using the EZ DNA Methylation-Gold kit (Zymo Research). Three genomic intervals encompassing CpG clusters (chrX:580,908–581,116 ...
-
bioRxiv - Immunology 2020Quote: ... and the resulting phagemid DNA was purified using ZymoPURE™ II Plasmid Midiprep Kit (Zymo Research).
-
bioRxiv - Microbiology 2021Quote: ... Yeast transformation was carried out using the Frozen-EZ Yeast Transformation II Kit (T2001, Zymo Research), according to manufacturer’s protocols.
-
bioRxiv - Genomics 2021Quote: ... and the 900 bp piece was gel purified using a gel DNA extraction kit (Zymo Research), then recirculized in a 20 µL reaction containing 60 ng of DNA and 1 µL of T4 DNA Ligase (Thermo Fisher Scientific ...
-
bioRxiv - Molecular Biology 2021Quote: ... The RNA in the supernatant was purified using the RNA Clean and Concentrate kit (Zymo Research) and excess anti-sense oligos were removed by treatment with Turbo DNase (Invitrogen) ...
-
bioRxiv - Physiology 2021Quote: ... purified from agarose gels with the Zymoclean Gel DNA Recovery Kit (Zymo Research, Irvine, CA, USA) according to the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2021Quote: ... Genomic DNA (gDNA) was extracted using the ZR Fungal/Bacterial DNA MiniPrep kit (D6005, Zymo Research). Shotgun metagenomic sequencing was performed for four T ...
-
bioRxiv - Molecular Biology 2021Quote: ... The PCR product was further purified using a Zymo DNA Clean and Concentrator Kit (Zymo # D4013).