Labshake search
Citations for Zymo Research :
3651 - 3700 of 6483 citations for Starch Microplate Assay Kit since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Synthetic Biology 2022Quote: ... Genomic DNA was extracted from sorted cells using the Genomic DNA Clean & Concentrator kit (Zymo Research). PCR fragments were amplified using KAPA HiFi HotStart DNA Polymerase with 2X Master Mix (Roche) ...
-
bioRxiv - Developmental Biology 2022Quote: ... DNA was extracted and purified using the ChIP DNA Clean and Concentrator kit (Zymo Research, #D5201) using the manufacturer’s protocol ...
-
bioRxiv - Developmental Biology 2022Quote: ... The purified DNA was then bisulfite converted using the EZ DNA Methylation-Gold Kit (Zymo, D5005).
-
bioRxiv - Neuroscience 2021Quote: ... Supernatants from both elutions were combined and purified using DNA Clean and Concentrator-5 Kit (Zymo). Library preparation was performed as described for ATAC- seq ...
-
bioRxiv - Neuroscience 2021Quote: ... RNA extraction was then performed with Zymo Quick-RNA Microprep kit (Zymo Research cat. no. R1051). 50-100 ng of RNA was then used to construct bulk RNA-seq libraries using the QuantSeq 3’ mRNA-Seq Library Prep Kit FWD for Illumina (Lexogen cat ...
-
bioRxiv - Molecular Biology 2021Quote: ... The final amplified libraries were purified using a DNA Clean & Concentrator-5 Kit (Zymo Research, D4013) according to the manufacturer’s protocol and eluted in 20 µl of Elution Buffer ...
-
bioRxiv - Molecular Biology 2021Quote: ... PCR digested fragments were purified from agarose gel by Zymoclean Gel DNA Recovery Kit (Zymo Research). Heavy and light chain full IgG p3BNC expression plasmids were divided to three parts for PCR amplification ...
-
bioRxiv - Molecular Biology 2021Quote: ... and 1μg was bisulfite-treated using the EZ DNA Methylation™ kit (Cat#D5001; Zymo Research), according to manufacturer instructions ...
-
bioRxiv - Immunology 2022Quote: ... brain and nasal wash was performed using the Direct-zol RNA miniprep kit (Zymo Research R2053) following the manufacturer protocol ...
-
bioRxiv - Genomics 2020Quote: ... Adaptor-ligated libraries were subjected to sodium bisulfite treatment using the Methylation-Gold Bisulfite kit (ZYMO) as outlined in the manufacturer’s instructions ...
-
bioRxiv - Genomics 2020Quote: RNA samples were extracted with Direct-zol™ RNA MiniPrep kit (Zymo Research, Tustin, CA, USA) according to the manufacturer’s instructions.
-
bioRxiv - Genomics 2020Quote: ... Bisulfite conversion was performed using the EZ DNA Methylation-Gold kit (Zymo Research, Cat. N: D5005) followed by library construction using the Accel-NGS® Methyl-Seq DNA Library kit (Swift Bioscience ...
-
Histone deacetylase inhibitors butyrate and bufexamac inhibit de novo HIV-1 infection in CD4 T-cellsbioRxiv - Microbiology 2020Quote: RNA was isolated from trizol lysates of cells using Direct-zol RNA Miniprep Kit (Zymo Research) following manufacturer’s instructions ...
-
bioRxiv - Genomics 2020Quote: ... DNA was purified using a genomic DNA Clean and Concentrator kit (Zymo Research Corp., Irvine, CA). Finally ...
-
bioRxiv - Genomics 2020Quote: ... amplification and library construction procedures were performed with Pico Methyl-SeqTM Library Prep Kit (Zymo Research) following the manufacturer’s instruction ...
-
bioRxiv - Genomics 2020Quote: ... and total RNA was isolated using the Direct-zol RNA MiniPrep Kit (Zymo Research, Irvine, CA). 5-6 µg total RNA that passed quality control metric (RIN >.9 ...
-
bioRxiv - Immunology 2021Quote: ... coli for amplification and purified with the ZymoPURE Plasmid Maxiprep Kit (Zymo Research, Irvine, CA, USA). The purified plasmid was then used for transient transfection in the ExpiCHO system (Thermo Fisher Scientific ...
-
bioRxiv - Genomics 2020Quote: Total RNA was extracted from RPTEC or kidney organoids with the Direct-zol MicroPrep Kit (Zymo) following manufacturer’s instructions ...
-
bioRxiv - Genomics 2020Quote: ... Both cohorts made use of the EZ-96 DNAm kit (shallow) (Zymo Research Corporation, Irvine, USA) to perform bisulfite conversion on the extracted leukocytic DNA ...
-
bioRxiv - Plant Biology 2020Quote: ... total RNA was extracted from bacterial lysates using Direct-zol RNA MiniPrep Plus kit (Zymo Research), treated with DNase I (Zymo Research ...
-
bioRxiv - Molecular Biology 2019Quote: ... Total RNA was extracted from transfected cells and media with Direct-zol RNA kit (Zymo Research), and DNase I in-column digestion was conducted to remove plasmids ...
-
bioRxiv - Genetics 2019Quote: ... RNA was isolated from plant tissue using the Zymopure RNA Extraction kit (Zymo Research, Irvine, CA), and reverse transcribed with the ThermoFischer Reverse Transcription kit ...
-
bioRxiv - Neuroscience 2019Quote: Total RNA was extracted from cell lysates using Direct-zol RNA Mini Prep kit (Zymo Research) in combination with peqGOLD TriFast (PeqLab Biotechnologie ...
-
bioRxiv - Cancer Biology 2019Quote: Total RNA was isolated from cells using the Direct-zol RNA miniprep kit (R2060, Zymo Research), with subsequent quantification using Nanodrop (Thermo Fisher Scientific) ...
-
bioRxiv - Plant Biology 2019Quote: ... RNA was extracted from each sample using the Direct-Zol™ RNA Miniprep Kit (Zymo Research) according to the kit instructions ...
-
Parallelized engineering of mutational models using piggyBac transposon delivery of CRISPR librariesbioRxiv - Bioengineering 2020Quote: ... Endotoxin-free plasmid library DNA was prepared using the ZymoPURE II Plasmid Maxiprep Kit (Zymo Research). To clone the library of gRNA pairs ...
-
bioRxiv - Molecular Biology 2019Quote: ... RNA was extracted from the resulting lysate using the Direct-zol RNA Miniprep Kit (R2070, Zymo) following manufacturer’s instructions ...
-
bioRxiv - Microbiology 2019Quote: ... Total RNA (including symbiont RNA) was then isolated using the Direct-zol RNA Kit (Zymo Research), and the isolated RNA was treated with DNase I (Qiagen ...
-
bioRxiv - Genetics 2019Quote: ... 500 ng genomic DNA was processed using an EZ DNA Methylation-Gold Kit™ (ZYMO Research), in accordance with the manufacturer’s instructions ...
-
bioRxiv - Cancer Biology 2019Quote: ... genomic DNA (gDNA) was isolated from cells using Quick-DNA Miniprep Kit (11-317AC, Zymo Research). 1.5-4.5 µg of gDNA from each cell line was digested with RsaI and HinfI ...
-
bioRxiv - Cancer Biology 2019Quote: Genomic DNA (gDNA) was isolated from cells using Quick-DNA Miniprep Kit (11-317AC, Zymo Research). 20 μL PCR reactions were performed using 50 ng gDNA and Phusion High-Fidelity DNA Polymerase (F-530 ...
-
bioRxiv - Genetics 2019Quote: ... and then the RNA was extracted using TRIzol and Direct-zol RNA miniprep kit (Zymo Research).
-
bioRxiv - Developmental Biology 2019Quote: DNA was extracted from single cell colonies using the ZR Duet DNA/RNA Miniprep Kit (Zymo). A 708 bp PCR product around the editing site of Satb2-272 was amplified using primers Satb2-seq-F ACTGGCCTGATCGTCTATCA and Satb2-seq-R GCCAGATCCTAGGTCTCTGT ...
-
bioRxiv - Microbiology 2020Quote: ... pJMC158 DNA was isolated from a clone using the ZR Plasmid Miniprep Classic Kit (Zymo Research), sequence confirmed ...
-
bioRxiv - Genomics 2020Quote: ... and total RNA was isolated using the Diret-zol RNA mini-prep kit (Zymo Research R2051). Sequencing libraries were prepared using the QuantSeq 3’-mRNA Seq Library Prep Kit for Illumina (Lexogen ...
-
bioRxiv - Pathology 2019Quote: ... and further purified and concentrated using DNA Clean and Concentrator Kit (Zymo Research, Irvine, CA, USA) according to the manufacturer’s protocol ...
-
bioRxiv - Immunology 2019Quote: RNA were isolated from purified CD4+ T cells using Direct-zol RNA Purification Kit (Zymo Research) and cDNA were generated using iScript Reverse Transcriptase (Bio-Rad) ...
-
bioRxiv - Genetics 2019Quote: ... PCR products were column purified using the ZR-96 DNA Clean-up Kit (Zymo Research, D4018) according to the manufacturer’s protocol ...
-
bioRxiv - Genetics 2019Quote: ... and RNA was extracted using the Direct-Zol RNA Extraction Kit (Zymo research, Irvine, CA, USA) following the manufacturer's instructions ...
-
bioRxiv - Bioengineering 2019Quote: ... Total RNA was purified using the Direct-Zol RNA miniprep kit (Zymo Research, Irvine, CA, USA) as described in the protocol ...
-
bioRxiv - Epidemiology 2019Quote: ... DNA was bisulphite-converted using the Zymo EZ DNA Methylation™ kit (Zymo, Irvine, CA, USA). Genome-wide methylation data were generated using the Infinium MethylationEPIC BeadChips (EPIC array ...
-
bioRxiv - Genomics 2020Quote: ... DNA conversion was carried out using the EZ DNA Methylation-Gold Kit (Zymo Research, CA, USA) following the manufacturer’s instructions ...
-
bioRxiv - Genetics 2021Quote: ... in vitro synthesized mRNA was purified with the RNA Clean and Concentrator Kit RCC (Zymo, R1013). 12.5 pg Cre or 15 pg Dre mRNA was injected into 1 cell stage embryos to promote recombination mediated inversion of the UFlip cassette at lox or rox sites ...
-
bioRxiv - Genetics 2021Quote: ... RNA from the monosome fraction was extracted using TRIzol LS and a Direct-zol kit (Zymo). The RNA was loaded on a Novex 15% TBE-Urea gel (Life Technologies ...
-
bioRxiv - Genetics 2020Quote: ... Total RNA was extracted from the supernatant using the Quick-RNA Plant Miniprep Kit (Zymo Research) with the inclusion of in-column DNAse I treatment ...
-
bioRxiv - Developmental Biology 2020Quote: ... DNA was bisulfite converted using an EZ DNA Methylation-Lightning™ Kit (Zymo Research Corporation, D5030T). PCR was performed to amplify the ELF5 and C19MC gene regions ...
-
bioRxiv - Genomics 2020Quote: ... Extracted DNA was purified with Genomic DNA Clean & Concentrator −10 kit (Zymo Research, Irvine, CA, USA). A total of 17.9 μg of high-molecular weight DNA was used for PacBio sequencing ...
-
bioRxiv - Microbiology 2021Quote: ... The RNA samples were afterward purified using the RNA Clean & Concentrator™ −5 kit (ZYMO RESEARCH) following the manufacturer’s instructions ...
-
bioRxiv - Neuroscience 2021Quote: Total RNA was extracted from thirty male adult heads using the RNA extraction kit (Zymo Research). After removal of genomic DNA using the DNA-free kit (AMBION ...
-
bioRxiv - Microbiology 2021Quote: DNA extraction was performed using a ZymoBIOMICS® -96 MagBead DNA kit (Zymo Research, Irvine, CA) or ZymoBIOMICS® DNA Miniprep kit (Zymo Research ...