Labshake search
Citations for Zymo Research :
301 - 350 of 6148 citations for RT PCR kit since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Genetics 2019Quote: ... These final PCR products were purified two times over silica columns (Zymo Research) and quantified using the KAPA SYBR FAST qPCR Master Mix (Kapa Biosystems ...
-
bioRxiv - Genomics 2020Quote: ... Eluted DNA was treated with Zymo OneStep PCR Inhibitor Removal columns (Zymo Research). Extractions were performed in a UV-sterilized laminar flow hood and all extraction instruments and bench spaces were sterilized with a 10% bleach solution or UV light ...
-
bioRxiv - Biochemistry 2022Quote: ... PCR-amplified DNA was purified and concentrated by spin column (Zymo Research #D4004) before being used to generate RNA.
-
bioRxiv - Genetics 2022Quote: ... PCR products were purified using a Zymo DNA Clean & Concentrator column (Zymo D4003). Size selection was performed on a 8% TBE-urea gel ...
-
bioRxiv - Genomics 2021Quote: ... Eluted DNA was treated with Zymo OneStep PCR Inhibitor Removal columns (Zymo Research).
-
bioRxiv - Synthetic Biology 2023Quote: ... PCR products were column-purified before cloning using DNA Clean & Concentrator (Zymo research).
-
bioRxiv - Microbiology 2023Quote: ... PCR products were pooled and concentrated using DNA Clean and Concentrate columns (Zymo). Insert (sgRNAs ...
-
bioRxiv - Immunology 2023Quote: ... PCR product/library were purified using DNA Clean and Concentrate-5 (Zymo Research) then ran on a tapestation to visualize nucleosome distribution ...
-
bioRxiv - Neuroscience 2024Quote: ... The PCR reaction product was cleaned (Zymo DNA Clean & Concentrator Cat. No D4013) and sequenced (Genewiz ...
-
bioRxiv - Molecular Biology 2023Quote: ... Round 1 PCRs were cleaned using DNA Binding Buffer (Zymo ZD4004-1-L) and UPrep Micro Spin Columns (Genesee Scientific 88–343) ...
-
bioRxiv - Microbiology 2024Quote: ... followed by pooling all PCR reactions and column purifying the product (Zymo Research). PCR products were 5’ phosphorylated with T4 polynucleotide kinase ...
-
bioRxiv - Cell Biology 2019Quote: RNA was isolated using a commercial kit (RNAmicro kit, Zymo Research), according to the manufacturer’s instructions ...
-
bioRxiv - Genomics 2023Quote: ... Plasmid is extracted from the bacterial culture using a 96-well mini-prep kit (Zymo kit, Zippy 96 plasmid kit). All clones are sequenced by Sanger sequencing at the site of the barcode using primer ACTTGTGTAGCGCCAAGTGC ...
-
bioRxiv - Molecular Biology 2020Quote: ... PCR products were purified using the DNA Clean & Concentrator-100 (Zymo, Cat. No. D4029) and sent for Sanger sequencing using a TIDE forward primer (Supplementary Table) ...
-
bioRxiv - Immunology 2022Quote: ... PCR amplification products were later purified using DNA Clean & ConcentratorTM −5 (Zymo Research, # D4004) following the protocol provided by the manufacturer.
-
bioRxiv - Biochemistry 2019Quote: ... PCR reactions were purified using a Select-a-size DNA Clean and Concentrator (Zymo) to remove adapter dimers ...
-
bioRxiv - Genomics 2021Quote: ... The PCR product was purified over a Zymo Clean and Concentrator column (Zymo Research), digested with AvrII and BglII ...
-
bioRxiv - Cell Biology 2023Quote: ... The amplified PCR products were purified using DNA Clean & Concentrator-5 (Zymo Research, D4014) according to the manufacturer’s instructions ...
-
bioRxiv - Genetics 2019Quote: ... and gel extraction kit (Zymoclean Gel DNA Recovery Kit) were from Zymo Research ...
-
bioRxiv - Bioengineering 2022Quote: ... using a commercial kit (ZymoPURE II Plasmid Maxiprep Kit; Zymo Research Corp). HEK293Ta cells (Genecopoeia ...
-
bioRxiv - Biophysics 2021Quote: ... Plasmids used for nucleofections were purified by Zymo midiprep kit (Zymo D4200) and concentrations were quantified by absorption at 260 nm ...
-
bioRxiv - Synthetic Biology 2023Quote: ... coli Transformation Kit (Zymo).
-
bioRxiv - Biophysics 2023Quote: ... Plasmids were purified by Zymo midiprep kit (Zymo D4200) and all cloning was confirmed by Sanger sequencing ...
-
bioRxiv - Microbiology 2023Quote: ... coli Transformation Kit (Zymo).
-
bioRxiv - Molecular Biology 2022Quote: ... ZymoPure Plasmid Midiprep kit and RNA Clean & Concentrator kit were purchased from Zymo Research ...
-
bioRxiv - Microbiology 2023Quote: ... RNA was isolated using a commercial kit (DirectZol RNA Miniprep kit, Zymo Research) following manufacturer instructions ...
-
bioRxiv - Biochemistry 2023Quote: ... ZymoPURE II Midiprep Kit or the ZymoPURE II Maxiprep Kit (all Zymo Research).
-
bioRxiv - Immunology 2023Quote: ... the RNeasy Plus kit (specifically, the Quick RNA miniprep plus kit, Zymo, USA) was utilized and RNA was quantitated with Qubit RNA HS (High Sensitivity ...
-
bioRxiv - Plant Biology 2019Quote: ... the DNA samples were placed through Zymo OneStep PCR inhibitor removal columns (Zymo, Irvine, CA) to remove any secondary metabolites that might inhibit PCR amplification ...
-
bioRxiv - Evolutionary Biology 2019Quote: ... Extracted DNA was run through a Zymo OneStep PCR Inhibitor Removal Column (Zymo, Irvine, CA) twice.
-
bioRxiv - Molecular Biology 2019Quote: ... The targeted region of the RARRES2 promoter was amplified with PCR (ZymoTaq PreMix, Zymo Research) using the following sets of primers specific to converted DNA ...
-
bioRxiv - Microbiology 2020Quote: ... The PCR product was purified with DNA Clean Concentrator-5 (Zymo Research, Irvine, CA, USA). Universal primers 27F ...
-
bioRxiv - Genetics 2023Quote: ... the PCR products were purified and concentrated using Zymo DNA Clean & Concentrator (Zymo Research, D4030) following the manufacturer’s instructions ...
-
bioRxiv - Molecular Biology 2023Quote: ... The PCR product was purified using Zymo DNA clean and concentrator column (Zymo Research, D4013) and ran on 6% native TBE gel ...
-
bioRxiv - Cancer Biology 2024Quote: ... PCR products were pooled and purified with a ZymoSpin V column with Reservoir (Zymo Research). Libraries were sequenced on an Illumina NextSeq 500 in the Vanderbilt Technologies for Advanced Genomics (VANTAGE ...
-
bioRxiv - Molecular Biology 2023Quote: ... DNA and RNA were extracted using commercial kits: Quick-DNA-fungal/bacterial MiniPrep™ kit (ZymoResearch) was used for DNA and Quick-RNA-fungal/bacterial MiniPrep™ kit (Zymo Research) was used for RNA ...
-
bioRxiv - Synthetic Biology 2022Quote: ... coli using GeneJet plasmid miniprep kit (ThermoScientific) or ZymoPURE plasmid midiprep kit (Zymo Research). Sequences of all plasmids were confirmed using Sanger sequencing performed by Eurofins Genomics ...
-
bioRxiv - Microbiology 2023Quote: ... coli using GeneJet plasmid miniprep kit (ThermoScientific) or ZymoPURE plasmid midiprep kit (Zymo Research). Sequences of all plasmids were confirmed using Sanger sequencing performed by Eurofins Genomics ...
-
bioRxiv - Microbiology 2021Quote: ... coli transformation kit (Zymo Research) or standard electro-transformation protocols ...
-
bioRxiv - Neuroscience 2020Quote: ... or MiniPrep Kit (R2052, Zymo Research ...
-
bioRxiv - Synthetic Biology 2020Quote: ... coli Transformation Kit (Zymo Research).
-
bioRxiv - Synthetic Biology 2021Quote: ... coli Transformation Kit from Zymo Research (Irvine ...
-
bioRxiv - Genomics 2021Quote: ... the RCC kit (Zymo Research).
-
bioRxiv - Developmental Biology 2020Quote: ... or Quick-RNA kit (Zymo). Reverse transcription was carried out by using the High-Capacity RNA-to-cDNA Kit (ThermoFisher) ...
-
bioRxiv - Developmental Biology 2023Quote: ... and RNA purification kit (Zymo). cDNA was generated using Maxima First Strand cDNA synthesis kit (Thermo Fisher Scientific) ...
-
bioRxiv - Synthetic Biology 2023Quote: ... coli Transformation Kit (Zymo Research). For each transformation ...
-
bioRxiv - Synthetic Biology 2024Quote: ... coli Transformation Kit (Zymo Research), and transformations were carried out using 50 ng of ligation product or plasmid ...
-
bioRxiv - Genetics 2023Quote: ... ZymoPure Midiprep Kit (Zymo Research) was used to prepare donor constructs for embryo injection ...
-
bioRxiv - Cancer Biology 2024Quote: ... coli Transformation Kit (Zymo Research). Plasmids were prepared following standard protocols ...
-
bioRxiv - Bioengineering 2019Quote: ... the PCR-amplified material was purified by ZymoClean agarose gel purification (Zymo Research, Inc., Irvine, CA) and column cleanup (Qiagen miniprep spin purification kit ...