Labshake search
Citations for Zymo Research :
1951 - 2000 of 6633 citations for Parallel Artificial Membrane Permeability Assay PAMPA Kit since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Molecular Biology 2022Quote: ... The product was cleaned up using RNA Clean & Concentrator-5 kit (ZYMO, R1013) and added into 20 μl of reverse transcription and strand-switching reaction containing 100 nM custom primer (5’ - phos/ ACTTGCCTGTCGCTCTATCTTCATTGATGGTGCCTACAG - 3’) ...
-
bioRxiv - Molecular Biology 2022Quote: ... rRNA-depleted RNA was purified by RNA Clean & Concentrator-5 kit (ZYMO, R1013) and then ligated to 50 pmol 3’ adapter (5’-rAppCTGTAGGCACCATCAAT - NH2-3’ ...
-
bioRxiv - Plant Biology 2022Quote: ... officinalis nodule tissue was extracted using Direct-zol RNA miniprep kits (ZYMO Research) according to the manufacturer’s protocol ...
-
bioRxiv - Plant Biology 2022Quote: ... The resulting amplicons were purified using Zymoclean Gel DNA Recovery Kit (Zymo Research). The amplicons were sent for Sanger sequencing (Eurofins Genomics ...
-
bioRxiv - Synthetic Biology 2022Quote: ... Each tube was processed with the ZymoPURE II Plasmid Midiprep Kit (Zymo Research). The resulting midipreps were pooled and a dilution of 10 ng/μL was prepared ...
-
bioRxiv - Synthetic Biology 2022Quote: ... Gel extraction was done using the Zymoclean Gel DNA Recovery Kit (Zymo Research) according to the manufacturer’s instructions.
-
bioRxiv - Physiology 2022Quote: ... Bisulfite conversion was performed with a EZ DNA Methylation-Gold Kit (Zymo Research) followed by PCR amplification with NEBNext Multiplex Oligos (New England Biolabs) ...
-
bioRxiv - Molecular Biology 2022Quote: ... RNA was isolated from each fraction using Direct-zol RNA kit (Zymo Research), and 200 ng of RNA from each compartment was used for reverse transcription with random primers as above ...
-
bioRxiv - Molecular Biology 2022Quote: RNA was purified from the samples using the Direct-zol kit (Zymo Research). Reverse transcription was performed according to manufacturer instructions using the Superscript IV kit (ThermoFisher ...
-
bioRxiv - Genomics 2022Quote: ... DNA was bisulfite converted using a commercially available kit (Zymo Research, Orange, CA). Illumina Infinium Human Methylation 450K Bead Chip and EPIC Bead Chip were used for genome-wide profiling of DNA methylation.24 The EPIC chip measures over 850 000 methylation sites ...
-
bioRxiv - Genetics 2022Quote: ... RNA was extracted with the Direct-zol RNA Mini-prep kit (Zymo Research) including on-column DNase treatment and transcribed into cDNA with the qScript cDNA Synthesis Kit (Quantabio) ...
-
bioRxiv - Genetics 2022Quote: ... RNA was extracted with the Direct-zol RNA Mini-prep kit (Zymo Research) including on-column DNase treatment ...
-
bioRxiv - Bioengineering 2022Quote: ... DNA products were purified using the DNA Clean & Concentrator-5 Kit (Zymo Research). All purified PCR products were visually checked for expected size via 1% agarose gel electrophoresis and assessed for purity and yield via Nanodrop (Thermo Fisher Scientific).
-
bioRxiv - Microbiology 2022Quote: ... and purified with the Quick-RNA Fungal/Bacterial Microprep Kit (Zymo Research Corp.) including a DNase I on column treatment.
-
bioRxiv - Genomics 2022Quote: ... Viral RNA was extracted using the Direct-zol-96 RNA Kits (ZYMO research) and used as a template for qRTPCR to measure viral copy number ...
-
bioRxiv - Cancer Biology 2022Quote: ... RNA was isolated using the Direct-zol RNA Microprep Kit (Zymo Research, R2061) and quantified using the Agilent High Sensitivity RNA ScreenTape (Agilent 5067-5579 ...
-
bioRxiv - Developmental Biology 2022Quote: ... followed by purification using the Direct-zol RNA miniprep kit (Zymo Research, Irvine). RNA quality and quantity was assessed using Bioanalyzer (Agilent ...
-
bioRxiv - Cancer Biology 2022Quote: ... RNA was isolated using Quick RNA Miniprep kit following manufacturer’s protocol (Zymo Research) and 5 μg of RNA was reverse transcribed using Maxima cDNA Synthesis Kit following manufacturer’s protocol (Fisher Scientific) ...
-
bioRxiv - Microbiology 2020Quote: ... and RNA was further extracted using the “RNA clean & concentrator” kit from Zymo according to the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2020Quote: ... and subsequently purified using the RNA Clean and Concentrate −5 kit (Zymo Research). RNA was then prepped for deep-sequencing using the TruSeq Stranded mRNA Library Preparation Kit (Illumina ...
-
bioRxiv - Microbiology 2020Quote: ... and viral RNA extracted using the Quick-RNA™ Viral Kit (Zymo Research), eluting in 20μl ...
-
bioRxiv - Microbiology 2020Quote: ... faecalis genomic DNA was performed using a ZymoBIOMICS DNA Miniprep Kit (Zymo Research). All PCR used for cloning were performed with high fidelity KOD Hot Start DNA Polymerase (EMD Millipore) ...
-
bioRxiv - Immunology 2020Quote: ... The tagged DNA was purified using DNA clean and concentrator kit (Zymo research). Fluorescently labeled DNA was transferred on to Zeta probe membrane (Bio Rad ...
-
bioRxiv - Microbiology 2021Quote: ... Total RNA was extracted using a Direct-zol RNA miniprep kit (Zymo Research) per the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2021Quote: Bisulfite treatment was performed using the EZ RNA methylation Kit (#R5001, Zymo Research). Briefly ...
-
bioRxiv - Molecular Biology 2020Quote: ... DNA was purified using Zymo ChIP DNA clean and concentrator kit (Zymo Research) and eluted in 20 μl ...
-
bioRxiv - Microbiology 2020Quote: ... Intracellular RNA was extracted using Direct-zol Miniprep RNA kit (Zymo Research, R2051s) per manufacturer’s instructions ...
-
bioRxiv - Microbiology 2021Quote: RNA was extracted using the Direct-zol RNA Miniprep Plus kit from Zymo Research according to manufacturer’s instructions ...
-
bioRxiv - Microbiology 2021Quote: ... and concentrated using the Zymobiomics RNA Clean & Concentrator Kit (Zymo Research, CA, USA). Ribosomal RNA was removed from total RNA and libraries were prepared using the Takara SMARTer Stranded Total RNA-Seq Kit v2 (Takara Bio Inc ...
-
bioRxiv - Microbiology 2020Quote: ... RNA isolation was performed using a Direct-zol™ RNA Kit (Zymo Research). To isolate RNA ...
-
bioRxiv - Microbiology 2020Quote: ... The resulting cDNA was purified using either the DNA Clean & Concentrator kit (Zymo) or 1.6x volumes of AMPure XP beads (Beckman Coulter) ...
-
bioRxiv - Microbiology 2021Quote: ... Resultant dsDNA was cleaned up using a DNA Clean & Concentrator Kit (Zymo Research) and used as an input for MinION sequencing.
-
bioRxiv - Microbiology 2021Quote: ... using the Quick-RNA(tm) Fecal/Soil Microbe MicroPrep Kit (Zymo Research, USA) according to the manufacturer’s instructions with some modifications (Manzoor et al. ...
-
bioRxiv - Neuroscience 2020Quote: ... RNA clean-up was performed using the RNA Clean & Concentrator kit (Zymo Research) after TRIzol phase separation according to the manufacturer’s protocol ...
-
bioRxiv - Immunology 2020Quote: ... Total RNA was isolated using Direct-zol RNA mini prep kit (Zymo Research) and reverse-transcribed using SuperScript II (Life Technologies ...
-
bioRxiv - Neuroscience 2020Quote: ... DNA purification was done using the Zymo clean and concentrator kit (Zymo, D4014).
-
bioRxiv - Cancer Biology 2020Quote: ... Quick-DNA/RNA™ Miniprep Plus Kit (Zymo Research, Irvine CA, USA, D7003T), was also used following manufacturer’s instructions ...
-
bioRxiv - Cancer Biology 2021Quote: ... RNA was extracted using the Direct-zol RNA microprep kit (Zymo; Cat# R2061). For megakaryocyte culture experiments ...
-
bioRxiv - Microbiology 2022Quote: ... were performed in triplicate with the Direct-zol RNA MiniPrep kit (Zymo Research), largely according to the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2022Quote: ... and cellular mRNA was extracted with DirectZol RNA extraction kit (Zymo Reseaerch, R2051). Two step RT-PCR was used to quantify relative expressions of intestinal cells markers (Sucrase Isomaltase for mature enterocytes ...
-
bioRxiv - Microbiology 2022Quote: ... Total RNA was isolated using the Quick RNA mini kit (Zymo Research, USA). Preparation of cDNA libraries for Quant-Seq ...
-
bioRxiv - Microbiology 2022Quote: ... the RNA was purified using the RNA Clean & Concentrator-5 kit (Zymo Research). The 3’ barcoded adaptors were ligated onto the RNA by mixing 5 µl of the dephosphorylated RNA with 100 µM of the barcoded adaptor and heating for 2 min at 70°C before transfer to ice ...
-
bioRxiv - Neuroscience 2022Quote: ... Total RNA was extracted using the Direct-zol RNA Miniprep Kit (Zymo Research) according to the manufacturer’s instructions and treated in-column with DNase I ...
-
bioRxiv - Molecular Biology 2022Quote: ... Genomic DNA was extracted using Quick-DNA Midiprep Plus Kit (Zymo Research, #D4075). Illumina sequencing libraries were prepared by first amplifying the sgRNA containing vector sequences from the gDNA and then using a second PCR reaction to append sequencing adapters55 ...
-
bioRxiv - Systems Biology 2022Quote: ... The transposed DNA fragments were purified by DNA Purification Kits (Zymo Research, # D4014), and amplified using PCR ...
-
bioRxiv - Immunology 2022Quote: ... Total RNA was extracted using a Direct-zol RNA Miniprep kit (Zymo Research) in accordance with the manufacturer’s instructions and stored at -70°C ...
-
bioRxiv - Microbiology 2022Quote: ... and the ZymoBIOMICS 96 MagBead DNA Kit (Cat# D4302, Zymo Research, Irvine, CA). We previously showed that the MagMAX Microbiome kit performs comparably-or-better than our standardized protocol ...
-
bioRxiv - Immunology 2022Quote: ... and RNA was extracted using the Direct-zol RNA MiniPrep kit (Zymo Research). cDNA synthesis was carried out using the iScript™ cDNA synthesis kit (Bio-Rad) ...
-
bioRxiv - Immunology 2022Quote: ... RNA was purified using the Direct-zol RNA miniprep kit (Zymo Research R2053) and the manufacturer’s protocol ...
-
bioRxiv - Immunology 2022Quote: ... Total RNA was isolated using the Direct-ZolTM RNA miniprep kit (Zymo Research) according to manufacturer’s instructions ...