Labshake search
Citations for Zymo Research :
1951 - 2000 of 6653 citations for Human Procollagen Type III N Terminal Propeptide PIIINP ELISA Kit since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cell Biology 2021Quote: ... RNA was then extracted using the Direct-zol Miniprep Kit (Zymo research, R2050) and Dnase treatment was performed on-column according to manufacturer’s instructions ...
-
bioRxiv - Cell Biology 2021Quote: ... RNA was then extracted using the direct-zol RNA microprep kit (Zymo Research). mRNA was enriched using the NEBNext Poly(A ...
-
bioRxiv - Plant Biology 2021Quote: ... total genomic DNA was converted using the EZ DNA Methylation Kit (ZYMO Research) and amplified with primers listed in Table S4 ...
-
bioRxiv - Plant Biology 2020Quote: ... and total RNA was extracted by using Quick-RNA Plant Kit (Zymo Research). The RNA concentrations were determined by using NanoDrop (DeNovix DS-11 FX) ...
-
bioRxiv - Synthetic Biology 2021Quote: ... These libraries were purified using the DNA Clean & Concentrator™-5 kit (Zymo) and eluted in water ...
-
bioRxiv - Synthetic Biology 2021Quote: ... The resulting crRNA was purified using RNA Clean & ConcentratorTM-5 kit (Zymo Research), and subsequently quantified using a NanoDrop 2000 spectrophotometer (Thermo Fisher Scientific) ...
-
bioRxiv - Plant Biology 2021Quote: ... The libraries were prepared with the EZ DNA Methylation-Gold Kit (Zymo Research) and the Accel-NGS® Methyl-Seq DNA Library Kit (Swift Biosciences ...
-
bioRxiv - Microbiology 2020Quote: ... purified it using the RNA Clean & Concentrate Kit (Zymo Research, Irvine, CA, USA), and verified the correct RNA length on a 15% TBE-urea gel (Bio-Rad Laboratories ...
-
bioRxiv - Systems Biology 2020Quote: RNA was isolated from Trizol using the RNA clean and concentrator kit (Zymo). The RNA was reverse transcribed using maxima RT and subjected to qPCR as described [26] ...
-
bioRxiv - Microbiology 2021Quote: ... and TP3 was extracted using a bacterial genomic DNA extraction kit from Zymo Research ...
-
bioRxiv - Microbiology 2021Quote: ... RNA was extracted using the Direct-zol RNA MiniPrep Plus kit (Zymo Research) and cDNA was made ...
-
bioRxiv - Microbiology 2021Quote: ... RNA was isolated from blood and PBMCs using Quick-RNA Viral Kit (Zymo). Total RNA was mixed with the respective primers and probes (all purchased from IDT ...
-
bioRxiv - Microbiology 2021Quote: ... DNA was cleaned using the OneStep™ PCR inhibitor removal kit (Zymo Research) prior to being used in quantitative PCR (qPCR) ...
-
bioRxiv - Synthetic Biology 2021Quote: ... and then gel extraction using Gel extraction kit (Zymo Research cat# 11-301C). gBlocks fragment and backbone plasmid was ligated by T4 DNA ligase (NEB cat# M0202S ...
-
bioRxiv - Microbiology 2021Quote: ... Total RNA was isolated with the Direct-zol RNA MiniPrep kit (Zymo #R2050), including DNase protocol ...
-
bioRxiv - Microbiology 2021Quote: ... Viral RNA was isolated using a ZR 96 Viral RNA kit (Zymo Research). The IAV genomic RNA segments were simultaneously amplified from 3 μl of purified RNA using the mRT-PCR described above (Zhou et al. ...
-
bioRxiv - Microbiology 2021Quote: Total RNA was extracted using Direct-zol RNA MiniPrep Kit (Zymo Research, USA) according to the manufacturer’s instructions ...
-
bioRxiv - Plant Biology 2021Quote: ... DNA libraries were converted using the EZ DNA methylation Gold kit (Zymo Research). Indexing-PCR was performed for 24 cycles for both WGS and WGBS libraries and adapter-dimers were removed as for WGS libraries [49] ...
-
bioRxiv - Molecular Biology 2020Quote: ... RNA was purified and concentrated using the RNA Clean & Concentrator™ kit (Zymo). On-column DNase digestion was performed to remove DNA contaminations ...
-
bioRxiv - Molecular Biology 2020Quote: ... Total RNA was isolated using the RNA clean and concentrator kit (Zymo Research), according to the manufacturer’s instructions ...
-
bioRxiv - Molecular Biology 2021Quote: ... and treated with sodium bisulfite using the EZ DNA Methylation kit (Zymo Research) according to the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2020Quote: ... samples were subjected to DNA extraction using a commercial DNA extraction kit (Zymo Research ...
-
bioRxiv - Microbiology 2020Quote: ... and RNA was extracted with Direct-zol RNA miniprep kit (Zymo, Irvine, California) according to the manufacturer’s instructions and was eluted in RNase-free water ...
-
bioRxiv - Microbiology 2020Quote: ... DNA fragments were further purified by use of a PCR purification kit (Zymo). Eluted DNA fragments were subjected to fragment analysis by capillary electrophoresis (Eton BioScience) ...
-
bioRxiv - Cell Biology 2021Quote: ... Total RNA was purified with Zymo RNA Clean & Concentrator-25 kit (Zymo Research). The rRNA was depleted with Ribo-Zero Gold rRNA Removal Kit (Illumina ...
-
bioRxiv - Cell Biology 2021Quote: ... total RNA was isolated with Zymo RNA Clean & Concentrator-25 kit (Zymo Research), RNA-seq libraries were constructed with VAHTS Total RNA-seq (H/M/R ...
-
bioRxiv - Genomics 2021Quote: ... and either gel purified using a Zymoclean Gel DNA Recovery Kit (Zymo Research) followed by Ampure XP bead purification (Beckman Coulter ...
-
bioRxiv - Biophysics 2020Quote: ... The plasmid was harvested using the Zymo Miniprep Kit (Zymo Research, Irivine, CA). To confirm that no mutations were introduced ...
-
bioRxiv - Genomics 2021Quote: ... The RNA was purified with the ZYMO RNA Clean & Concentration kit (Zymo, R1013) again and eluted in 15 µl of nuclease-free water ...
-
bioRxiv - Cell Biology 2020Quote: ... and bisulfite-treated using the EZ DNA Methylation-Lightning Kit (Zymo Research, D5030). Preparative-scale PCR was performed ...
-
bioRxiv - Cell Biology 2021Quote: ... RNA was isolated using Direct-zol RNA MiniPrep kit (Zymo Research, Irvine, CA). cDNA was made from isolated RNA using oligo (dt) ...
-
bioRxiv - Neuroscience 2022Quote: ... the product was purified with the DNA Clean & Concentrator-5 Kit (Zymo Research). 20 μl tagmented DNA was PCR amplified with NEBNext High-Fidelity PCR Master mix and forward and reverse UDI primers ...
-
bioRxiv - Molecular Biology 2022Quote: ... Samples were purified with a Zymo DNA Clean and Concentrator kit (Zymo Research) according to manufacturer instructions and eluted in 10µL 10mM Tris-HCl ...
-
bioRxiv - Genomics 2022Quote: ... and tissues was extracted using a Direct-zol RNA MicroPrep kit (Zymo Research) with an on filter DNAse treatment following the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2022Quote: ... PCR products were purified with the DNA Clean and Concentrator kit (Zymo Research) as per manufacturer’s protocol ...
-
bioRxiv - Neuroscience 2022Quote: ... Bisulfite conversion was performed with the EZ DNA Methylation-Gold Kit (Zymo Research) before carrying out PCR amplification with NEBNext Multiplex Oligos (New England Biolabs ...
-
bioRxiv - Molecular Biology 2022Quote: ... The tagged DNA was purified with the DNA Clean ConcentratorTM5 Kit (Zymo Research). The samples were pre-amplified with the Nextera Index kit and the Nextera DNA Library Prep kit (both from Illumina) ...
-
bioRxiv - Evolutionary Biology 2022Quote: ... The DNase treated products were cleaned with Quick-RNA MiniPrep Kit (Zymo Research), then validated on agarose gel and concentration was measured with Epoch Microplate Spectrophotometer (BioTek Instruments ...
-
bioRxiv - Evolutionary Biology 2022Quote: ... A second cleaning step was conducted with Quick-RNA MiniPrep Kit (Zymo Research). Products were eluted with 16 μl nuclease-free water and concentration was measured with NanoDrop (Thermo Fisher Scientific).
-
bioRxiv - Genetics 2022Quote: ... Genomic DNA was isolated using the Quick-DNA Miniprep Kit (Zymo Research# D3024) following the manufacturer’s protocol ...
-
bioRxiv - Genetics 2022Quote: ... and used the Quick-DNA 96 Plus kit (Zymo Research, Irvine, CA, USA) to extract genomic DNA ...
-
bioRxiv - Synthetic Biology 2022Quote: ... Plasmid DNA was prepared by the plasmid miniprep-classic kit (Zymo Research, D4015). DNA sequencing used Quintarabio DNA basic sequencing service ...
-
bioRxiv - Molecular Biology 2022Quote: Total RNA was isolated using the Direct-zol™ RNA kit (Zymo Research). RNA was quantified using a Qubit RNA Assay Kit (Life Technologies) ...
-
bioRxiv - Molecular Biology 2022Quote: ... The product was cleaned up using RNA Clean & Concentrator-5 kit (ZYMO, R1013) and added into 20 μl of reverse transcription and strand-switching reaction containing 100 nM custom primer (5’ - phos/ ACTTGCCTGTCGCTCTATCTTCATTGATGGTGCCTACAG - 3’) ...
-
bioRxiv - Molecular Biology 2022Quote: ... rRNA-depleted RNA was purified by RNA Clean & Concentrator-5 kit (ZYMO, R1013) and then ligated to 50 pmol 3’ adapter (5’-rAppCTGTAGGCACCATCAAT - NH2-3’ ...
-
bioRxiv - Plant Biology 2022Quote: ... officinalis nodule tissue was extracted using Direct-zol RNA miniprep kits (ZYMO Research) according to the manufacturer’s protocol ...
-
bioRxiv - Plant Biology 2022Quote: ... The resulting amplicons were purified using Zymoclean Gel DNA Recovery Kit (Zymo Research). The amplicons were sent for Sanger sequencing (Eurofins Genomics ...
-
bioRxiv - Synthetic Biology 2022Quote: ... Each tube was processed with the ZymoPURE II Plasmid Midiprep Kit (Zymo Research). The resulting midipreps were pooled and a dilution of 10 ng/μL was prepared ...
-
bioRxiv - Synthetic Biology 2022Quote: ... Gel extraction was done using the Zymoclean Gel DNA Recovery Kit (Zymo Research) according to the manufacturer’s instructions.
-
bioRxiv - Physiology 2022Quote: ... Bisulfite conversion was performed with a EZ DNA Methylation-Gold Kit (Zymo Research) followed by PCR amplification with NEBNext Multiplex Oligos (New England Biolabs) ...