Labshake search
Citations for Zymo Research :
1901 - 1950 of 6483 citations for Starch Microplate Assay Kit since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cell Biology 2020Quote: ... and bisulfite-treated using the EZ DNA Methylation-Lightning Kit (Zymo Research, D5030). Preparative-scale PCR was performed ...
-
bioRxiv - Cell Biology 2021Quote: ... RNA was isolated using Direct-zol RNA MiniPrep kit (Zymo Research, Irvine, CA). cDNA was made from isolated RNA using oligo (dt) ...
-
bioRxiv - Neuroscience 2022Quote: ... the product was purified with the DNA Clean & Concentrator-5 Kit (Zymo Research). 20 μl tagmented DNA was PCR amplified with NEBNext High-Fidelity PCR Master mix and forward and reverse UDI primers ...
-
bioRxiv - Molecular Biology 2022Quote: ... Samples were purified with a Zymo DNA Clean and Concentrator kit (Zymo Research) according to manufacturer instructions and eluted in 10µL 10mM Tris-HCl ...
-
bioRxiv - Genomics 2022Quote: ... and tissues was extracted using a Direct-zol RNA MicroPrep kit (Zymo Research) with an on filter DNAse treatment following the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2022Quote: ... PCR products were purified with the DNA Clean and Concentrator kit (Zymo Research) as per manufacturer’s protocol ...
-
bioRxiv - Neuroscience 2022Quote: ... Bisulfite conversion was performed with the EZ DNA Methylation-Gold Kit (Zymo Research) before carrying out PCR amplification with NEBNext Multiplex Oligos (New England Biolabs ...
-
bioRxiv - Molecular Biology 2022Quote: ... The tagged DNA was purified with the DNA Clean ConcentratorTM5 Kit (Zymo Research). The samples were pre-amplified with the Nextera Index kit and the Nextera DNA Library Prep kit (both from Illumina) ...
-
bioRxiv - Evolutionary Biology 2022Quote: ... The DNase treated products were cleaned with Quick-RNA MiniPrep Kit (Zymo Research), then validated on agarose gel and concentration was measured with Epoch Microplate Spectrophotometer (BioTek Instruments ...
-
bioRxiv - Evolutionary Biology 2022Quote: ... A second cleaning step was conducted with Quick-RNA MiniPrep Kit (Zymo Research). Products were eluted with 16 μl nuclease-free water and concentration was measured with NanoDrop (Thermo Fisher Scientific).
-
bioRxiv - Genetics 2022Quote: ... Genomic DNA was isolated using the Quick-DNA Miniprep Kit (Zymo Research# D3024) following the manufacturer’s protocol ...
-
bioRxiv - Genetics 2022Quote: ... and used the Quick-DNA 96 Plus kit (Zymo Research, Irvine, CA, USA) to extract genomic DNA ...
-
bioRxiv - Synthetic Biology 2022Quote: ... Plasmid DNA was prepared by the plasmid miniprep-classic kit (Zymo Research, D4015). DNA sequencing used Quintarabio DNA basic sequencing service ...
-
bioRxiv - Molecular Biology 2022Quote: Total RNA was isolated using the Direct-zol™ RNA kit (Zymo Research). RNA was quantified using a Qubit RNA Assay Kit (Life Technologies) ...
-
bioRxiv - Molecular Biology 2022Quote: ... The product was cleaned up using RNA Clean & Concentrator-5 kit (ZYMO, R1013) and added into 20 μl of reverse transcription and strand-switching reaction containing 100 nM custom primer (5’ - phos/ ACTTGCCTGTCGCTCTATCTTCATTGATGGTGCCTACAG - 3’) ...
-
bioRxiv - Molecular Biology 2022Quote: ... rRNA-depleted RNA was purified by RNA Clean & Concentrator-5 kit (ZYMO, R1013) and then ligated to 50 pmol 3’ adapter (5’-rAppCTGTAGGCACCATCAAT - NH2-3’ ...
-
bioRxiv - Plant Biology 2022Quote: ... officinalis nodule tissue was extracted using Direct-zol RNA miniprep kits (ZYMO Research) according to the manufacturer’s protocol ...
-
bioRxiv - Plant Biology 2022Quote: ... The resulting amplicons were purified using Zymoclean Gel DNA Recovery Kit (Zymo Research). The amplicons were sent for Sanger sequencing (Eurofins Genomics ...
-
bioRxiv - Synthetic Biology 2022Quote: ... Each tube was processed with the ZymoPURE II Plasmid Midiprep Kit (Zymo Research). The resulting midipreps were pooled and a dilution of 10 ng/μL was prepared ...
-
bioRxiv - Synthetic Biology 2022Quote: ... Gel extraction was done using the Zymoclean Gel DNA Recovery Kit (Zymo Research) according to the manufacturer’s instructions.
-
bioRxiv - Physiology 2022Quote: ... Bisulfite conversion was performed with a EZ DNA Methylation-Gold Kit (Zymo Research) followed by PCR amplification with NEBNext Multiplex Oligos (New England Biolabs) ...
-
bioRxiv - Molecular Biology 2022Quote: ... RNA was isolated from each fraction using Direct-zol RNA kit (Zymo Research), and 200 ng of RNA from each compartment was used for reverse transcription with random primers as above ...
-
bioRxiv - Molecular Biology 2022Quote: RNA was purified from the samples using the Direct-zol kit (Zymo Research). Reverse transcription was performed according to manufacturer instructions using the Superscript IV kit (ThermoFisher ...
-
bioRxiv - Genomics 2022Quote: ... DNA was bisulfite converted using a commercially available kit (Zymo Research, Orange, CA). Illumina Infinium Human Methylation 450K Bead Chip and EPIC Bead Chip were used for genome-wide profiling of DNA methylation.24 The EPIC chip measures over 850 000 methylation sites ...
-
bioRxiv - Genetics 2022Quote: ... RNA was extracted with the Direct-zol RNA Mini-prep kit (Zymo Research) including on-column DNase treatment and transcribed into cDNA with the qScript cDNA Synthesis Kit (Quantabio) ...
-
bioRxiv - Genetics 2022Quote: ... RNA was extracted with the Direct-zol RNA Mini-prep kit (Zymo Research) including on-column DNase treatment ...
-
bioRxiv - Bioengineering 2022Quote: ... DNA products were purified using the DNA Clean & Concentrator-5 Kit (Zymo Research). All purified PCR products were visually checked for expected size via 1% agarose gel electrophoresis and assessed for purity and yield via Nanodrop (Thermo Fisher Scientific).
-
bioRxiv - Microbiology 2022Quote: ... and purified with the Quick-RNA Fungal/Bacterial Microprep Kit (Zymo Research Corp.) including a DNase I on column treatment.
-
bioRxiv - Genomics 2022Quote: ... Viral RNA was extracted using the Direct-zol-96 RNA Kits (ZYMO research) and used as a template for qRTPCR to measure viral copy number ...
-
bioRxiv - Cancer Biology 2022Quote: ... RNA was isolated using the Direct-zol RNA Microprep Kit (Zymo Research, R2061) and quantified using the Agilent High Sensitivity RNA ScreenTape (Agilent 5067-5579 ...
-
bioRxiv - Developmental Biology 2022Quote: ... followed by purification using the Direct-zol RNA miniprep kit (Zymo Research, Irvine). RNA quality and quantity was assessed using Bioanalyzer (Agilent ...
-
bioRxiv - Cancer Biology 2022Quote: ... RNA was isolated using Quick RNA Miniprep kit following manufacturer’s protocol (Zymo Research) and 5 μg of RNA was reverse transcribed using Maxima cDNA Synthesis Kit following manufacturer’s protocol (Fisher Scientific) ...
-
bioRxiv - Microbiology 2020Quote: ... and RNA was further extracted using the “RNA clean & concentrator” kit from Zymo according to the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2020Quote: ... and subsequently purified using the RNA Clean and Concentrate −5 kit (Zymo Research). RNA was then prepped for deep-sequencing using the TruSeq Stranded mRNA Library Preparation Kit (Illumina ...
-
bioRxiv - Microbiology 2020Quote: ... and viral RNA extracted using the Quick-RNA™ Viral Kit (Zymo Research), eluting in 20μl ...
-
bioRxiv - Microbiology 2020Quote: ... faecalis genomic DNA was performed using a ZymoBIOMICS DNA Miniprep Kit (Zymo Research). All PCR used for cloning were performed with high fidelity KOD Hot Start DNA Polymerase (EMD Millipore) ...
-
bioRxiv - Immunology 2020Quote: ... The tagged DNA was purified using DNA clean and concentrator kit (Zymo research). Fluorescently labeled DNA was transferred on to Zeta probe membrane (Bio Rad ...
-
bioRxiv - Microbiology 2021Quote: ... Total RNA was extracted using a Direct-zol RNA miniprep kit (Zymo Research) per the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2021Quote: Bisulfite treatment was performed using the EZ RNA methylation Kit (#R5001, Zymo Research). Briefly ...
-
bioRxiv - Molecular Biology 2020Quote: ... DNA was purified using Zymo ChIP DNA clean and concentrator kit (Zymo Research) and eluted in 20 μl ...
-
bioRxiv - Microbiology 2020Quote: ... Intracellular RNA was extracted using Direct-zol Miniprep RNA kit (Zymo Research, R2051s) per manufacturer’s instructions ...
-
bioRxiv - Microbiology 2021Quote: RNA was extracted using the Direct-zol RNA Miniprep Plus kit from Zymo Research according to manufacturer’s instructions ...
-
bioRxiv - Microbiology 2021Quote: ... and concentrated using the Zymobiomics RNA Clean & Concentrator Kit (Zymo Research, CA, USA). Ribosomal RNA was removed from total RNA and libraries were prepared using the Takara SMARTer Stranded Total RNA-Seq Kit v2 (Takara Bio Inc ...
-
bioRxiv - Microbiology 2020Quote: ... RNA isolation was performed using a Direct-zol™ RNA Kit (Zymo Research). To isolate RNA ...
-
bioRxiv - Microbiology 2020Quote: ... The resulting cDNA was purified using either the DNA Clean & Concentrator kit (Zymo) or 1.6x volumes of AMPure XP beads (Beckman Coulter) ...
-
bioRxiv - Immunology 2019Quote: ... DNA was purified using the ChIP DNA Clean & Concentrator Kit (Zymo Research, 5205) and stored at −20 °C for qPCR analysis ...
-
bioRxiv - Microbiology 2021Quote: ... Resultant dsDNA was cleaned up using a DNA Clean & Concentrator Kit (Zymo Research) and used as an input for MinION sequencing.
-
bioRxiv - Microbiology 2021Quote: ... using the Quick-RNA(tm) Fecal/Soil Microbe MicroPrep Kit (Zymo Research, USA) according to the manufacturer’s instructions with some modifications (Manzoor et al. ...
-
bioRxiv - Neuroscience 2020Quote: ... RNA clean-up was performed using the RNA Clean & Concentrator kit (Zymo Research) after TRIzol phase separation according to the manufacturer’s protocol ...
-
bioRxiv - Immunology 2020Quote: ... Total RNA was isolated using Direct-zol RNA mini prep kit (Zymo Research) and reverse-transcribed using SuperScript II (Life Technologies ...