Labshake search
Citations for Zymo Research :
101 - 150 of 6216 citations for Rat Vacuole Membrane Protein 1 VMP1 ELISA Kit since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Plant Biology 2023Quote: ... The adapter-ligated DNA molecules were purified using 1× Agencourt AMPure XP magnetic beads and were subjected to bisulfite conversion using ZYMO EZ DNA Methylation-Gold Kit (Zymo, Cat. #D5005). Libraries were then amplified by PCR using 20 μL of bisulfite-converted DNA molecules ...
-
bioRxiv - Molecular Biology 2023Quote: ... at 37°C for 1 h and further cleaned up by using a Zymo RNA Clean and Concentrator-5 purification kit (Zymo Research, R1016). All the oligos used in the library preparation are noted in Supplementary Table 6a.
-
bioRxiv - Microbiology 2024Quote: ... The amplified promoter and coding PIGJ DNA sequence were first purified from 1% agarose gels using the ZymocleanTM Gel DNA recovery kit (Zymo Research, #D4007) and assembled in frame into the digested pLIC-HA -DHFR-TS plasmid in frame with the 3x HA tag using the NEBuilder HiFi DNA Assembly cloning Kit (NEB ...
-
bioRxiv - Genomics 2023Quote: ... Plasmid is extracted from the bacterial culture using a 96-well mini-prep kit (Zymo kit, Zippy 96 plasmid kit). All clones are sequenced by Sanger sequencing at the site of the barcode using primer ACTTGTGTAGCGCCAAGTGC ...
-
bioRxiv - Genetics 2019Quote: ... and gel extraction kit (Zymoclean Gel DNA Recovery Kit) were from Zymo Research ...
-
bioRxiv - Bioengineering 2022Quote: ... using a commercial kit (ZymoPURE II Plasmid Maxiprep Kit; Zymo Research Corp). HEK293Ta cells (Genecopoeia ...
-
bioRxiv - Biophysics 2021Quote: ... Plasmids used for nucleofections were purified by Zymo midiprep kit (Zymo D4200) and concentrations were quantified by absorption at 260 nm ...
-
bioRxiv - Synthetic Biology 2023Quote: ... coli Transformation Kit (Zymo).
-
bioRxiv - Biophysics 2023Quote: ... Plasmids were purified by Zymo midiprep kit (Zymo D4200) and all cloning was confirmed by Sanger sequencing ...
-
bioRxiv - Microbiology 2023Quote: ... coli Transformation Kit (Zymo).
-
bioRxiv - Molecular Biology 2022Quote: ... the aqueous phase was diluted back in TRizol reagent (1:3) to proceed with RNA purification by zymodirect RNA kit (Zymo research, cat. R2051). The quality of RNA samples was assessed using Agilent 2200 TapeStation (Agilent Technologies ...
-
bioRxiv - Microbiology 2022Quote: ... PCR products were separated by electrophoresis on a 1% agarose gel and purified using the Zymoclean Gel DNA recovery Kit (Zymo Research, Irvine, CA). The purified DNA fragments were then submitted for Sanger sequencing (GENEWIZ ...
-
bioRxiv - Plant Biology 2022Quote: ... Fragments were resolved with gel electrophoresis (1% agarose in 1x TAE buffer) and excised using the Zymoclean Gel DNA Recovery Kit (Zymo Research; Ref.: D4008) for elution of high-concentration ultra-pure DNA ...
-
bioRxiv - Molecular Biology 2022Quote: ... Two-third of final flag elute was taken for DNase treatment using NEB DNase 1 (M0303) and RNA was purified using RNA Clean and Concentrator Kit (Zymo Research, R1015/R1017). The final RNA concentration was determined using Qubit RNA high Sensitivity Assay Kit and 100ng of RIP-purified RNA was used for cDNA library preparation using NEBNext Ultra II directional RNA library kit (NEB ...
-
bioRxiv - Cancer Biology 2022Quote: ... The outer PCR products amplified using primer #1 and #2 were purified and concentrated using the DNA Clean and Concentrator 5 kit (Zymo Research, Orange, CA) and eluted in 20ul of TE buffer ...
-
bioRxiv - Evolutionary Biology 2023Quote: PCR products were visualized by agarose gel (1%) electrophoresis then extracted and purified using Zymoclean Gel DNA Recovery Kit (Zymo Research Lot. #213587) following manufacturer protocols ...
-
bioRxiv - Genetics 2024Quote: ... 1 µg of genomic DNA per sample was subjected to bisulfite conversion using the EZ DNA Methylation Kit (Zymo research Cat. no. D5001) following the manufacturer’s instructions ...
-
bioRxiv - Synthetic Biology 2024Quote: ... coli DH5α λpir (Table 1) was prepared using the commercially available Mix and Go™ transformation kit (Zymo Research International, Irvin, CA, USA) according to the manufacturer’s indications ...
-
bioRxiv - Molecular Biology 2022Quote: ... ZymoPure Plasmid Midiprep kit and RNA Clean & Concentrator kit were purchased from Zymo Research ...
-
bioRxiv - Microbiology 2023Quote: ... RNA was isolated using a commercial kit (DirectZol RNA Miniprep kit, Zymo Research) following manufacturer instructions ...
-
bioRxiv - Biochemistry 2023Quote: ... ZymoPURE II Midiprep Kit or the ZymoPURE II Maxiprep Kit (all Zymo Research).
-
bioRxiv - Immunology 2023Quote: ... the RNeasy Plus kit (specifically, the Quick RNA miniprep plus kit, Zymo, USA) was utilized and RNA was quantitated with Qubit RNA HS (High Sensitivity ...
-
bioRxiv - Molecular Biology 2019Quote: ... the membranes were removed from their plastic housing with a razor blade and soaked in 500 µL RNA lysis buffer (Zymo R1050) at room temperature for 15 min to make a neurite lysate ...
-
bioRxiv - Molecular Biology 2021Quote: ... the membranes were removed from the insert using a razor blade and were soaked in 500 μL RNA lysis buffer (Zymo, #R1050) at room temperature for 15 min ...
-
bioRxiv - Immunology 2020Quote: Total RNA was extracted from 1 × 105 cells using the Quick-RNA MiniPrep kit with Zymo-Spin IIICG columns (Zymo Research, Irvine, CA USA) as per manufacturer’s instructions ...
-
bioRxiv - Microbiology 2019Quote: ... total DNA or total RNA was extracted from 1−3 × 106 cells using the Quick-DNA or Quick-RNA Miniprep Kits (Zymo Research, Irvine, CA USA) respectively ...
-
bioRxiv - Genomics 2020Quote: Bisulfite conversion of 1 ug genomic DNA was performed using the EZ-96 DNA Methylation Kit (Deep Well Format) (Zymo Research; Irvine, CA, USA) according to the manufacturer’s instructions (www.zymoresearch.com) ...
-
bioRxiv - Physiology 2023Quote: ... Complementary DNA (cDNA) was synthesized from 1 to 2 μg of RNA using High-Capacity RNA-to-cDNA™ Kit (Zymo Research, Irvine, CA). Quantitative real-time polymerase chain reaction (qPCR ...
-
bioRxiv - Molecular Biology 2023Quote: ... DNA and RNA were extracted using commercial kits: Quick-DNA-fungal/bacterial MiniPrep™ kit (ZymoResearch) was used for DNA and Quick-RNA-fungal/bacterial MiniPrep™ kit (Zymo Research) was used for RNA ...
-
bioRxiv - Synthetic Biology 2022Quote: ... coli using GeneJet plasmid miniprep kit (ThermoScientific) or ZymoPURE plasmid midiprep kit (Zymo Research). Sequences of all plasmids were confirmed using Sanger sequencing performed by Eurofins Genomics ...
-
bioRxiv - Microbiology 2023Quote: ... coli using GeneJet plasmid miniprep kit (ThermoScientific) or ZymoPURE plasmid midiprep kit (Zymo Research). Sequences of all plasmids were confirmed using Sanger sequencing performed by Eurofins Genomics ...
-
bioRxiv - Microbiology 2024Quote: ... The three PCR fragments were purified (Zymo DNA Clean and Concentrator kit: ‘Zymo kit’) and used in a 1:1:1 molar ratio Golden Gate assembly reaction with BsaI (NEB ...
-
bioRxiv - Microbiology 2021Quote: ... coli transformation kit (Zymo Research) or standard electro-transformation protocols ...
-
bioRxiv - Neuroscience 2020Quote: ... or MiniPrep Kit (R2052, Zymo Research ...
-
bioRxiv - Synthetic Biology 2020Quote: ... coli Transformation Kit (Zymo Research).
-
bioRxiv - Synthetic Biology 2021Quote: ... coli Transformation Kit from Zymo Research (Irvine ...
-
bioRxiv - Genomics 2021Quote: ... the RCC kit (Zymo Research).
-
bioRxiv - Developmental Biology 2020Quote: ... or Quick-RNA kit (Zymo). Reverse transcription was carried out by using the High-Capacity RNA-to-cDNA Kit (ThermoFisher) ...
-
bioRxiv - Synthetic Biology 2023Quote: ... coli Transformation Kit (Zymo Research). For each transformation ...
-
bioRxiv - Developmental Biology 2023Quote: ... and RNA purification kit (Zymo). cDNA was generated using Maxima First Strand cDNA synthesis kit (Thermo Fisher Scientific) ...
-
bioRxiv - Genetics 2023Quote: ... ZymoPure Midiprep Kit (Zymo Research) was used to prepare donor constructs for embryo injection ...
-
bioRxiv - Microbiology 2024Quote: ... Correct amplicons were isolated by Zymo PCR purification kit (Zymo Research). The PCR products were cloned into a PCR linearized pEcgRNA-guide plasmid to make the pEcgRNA-guide-RT plasmid using In-fusion® HD-cloning kit (Takara Bio ...
-
bioRxiv - Synthetic Biology 2024Quote: ... coli Transformation Kit (Zymo Research), and transformations were carried out using 50 ng of ligation product or plasmid ...
-
bioRxiv - Cancer Biology 2024Quote: ... coli Transformation Kit (Zymo Research). Plasmids were prepared following standard protocols ...
-
bioRxiv - Biochemistry 2021Quote: ... Zyppy™ Plasmid Miniprep kit and DNA Clean & Concentrator™ kit were purchased from Zymo Research ...
-
bioRxiv - Developmental Biology 2020Quote: ... Total RNA was isolated from using DNA/RNA Duet Kit miniprep kit (Zymo Research, USA).
-
bioRxiv - Genetics 2022Quote: ... cerevisiae temperature-sensitive strain TSA64 en masse using EZ Kit Yeast Transformation kit (Zymo Research). The entire transformed library was grown in selective media (YPD + clonNAT ...
-
bioRxiv - Genetics 2024Quote: ... cerevisiae double mutant strain sml1Δ rad53Δ using the EZ Kit Yeast Transformation kit (Zymo Research) to obtain ∼1,000,000 clones per region ...
-
bioRxiv - Molecular Biology 2023Quote: ... 1 ml Trizol (R2050-1, Zymo Research) as well as 200 µl chloroform were added to the interface and phase separation and removal were repeated ...
-
bioRxiv - Synthetic Biology 2022Quote: ... whereas Zymoclean Gel DNA Recovery Kit and Zymoprep Yeast Plasmid Miniprep Kits were purchased from Zymo Research (Irvine ...