Labshake search
Citations for Zymo Research :
101 - 150 of 564 citations for Nonanoic acid reaction products with diethanolamine since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cell Biology 2021Quote: ... selective media with 5-fluoroorotic acid (Zymo Research, Tustin, CA), or YPD selective media (YPD G418+) ...
-
bioRxiv - Molecular Biology 2021Quote: ... RNA products were concentrated using the RNA Clean & Concentrator kit from Zymo (R1015), and 15 μl of sample was resolved in an 8% polyacrylamide gel in the presence of 7M Urea and 3ug/ml ethidium bromide (Figure S2) ...
-
bioRxiv - Molecular Biology 2021Quote: ... The PCR product was purified using DNA Clean & Concentrator-25 kit (Zymo Research). Purified PCR product was digested with Hpy188I (New England Biolabs ...
-
bioRxiv - Genomics 2020Quote: ... The final product was purified with DNA Clean and Concentrator kit (Zymo Research).
-
bioRxiv - Bioengineering 2020Quote: ... All PCR products were purified using the DNA Clean & Concentrator kit (Zymo Research) according to manufacturer’s instructions and the concentration of the PCR product was quantified on a NanoDrop (Thermo Fisher Scientific) ...
-
bioRxiv - Neuroscience 2020Quote: ... PCR products were purified using DNA Clean & Concentrator™-100 kit (Zymo Research) using a 1:5 ratio of PCR solution and DNA binding buffer ...
-
bioRxiv - Cancer Biology 2020Quote: ... The cDNA products were concentrated using cDNA Clean & Concentrator-5 Kit (Zymo Research) followed bead cleanup using 0.6X AMPure XP Beads (Beckman Coulter ...
-
bioRxiv - Neuroscience 2022Quote: ... the product was purified with the DNA Clean & Concentrator-5 Kit (Zymo Research). 20 μl tagmented DNA was PCR amplified with NEBNext High-Fidelity PCR Master mix and forward and reverse UDI primers ...
-
bioRxiv - Microbiology 2022Quote: ... PCR products were purified with the DNA Clean and Concentrator kit (Zymo Research) as per manufacturer’s protocol ...
-
bioRxiv - Evolutionary Biology 2022Quote: ... The DNase treated products were cleaned with Quick-RNA MiniPrep Kit (Zymo Research), then validated on agarose gel and concentration was measured with Epoch Microplate Spectrophotometer (BioTek Instruments ...
-
bioRxiv - Molecular Biology 2022Quote: ... The product was cleaned up using RNA Clean & Concentrator-5 kit (ZYMO, R1013) and added into 20 μl of reverse transcription and strand-switching reaction containing 100 nM custom primer (5’ - phos/ ACTTGCCTGTCGCTCTATCTTCATTGATGGTGCCTACAG - 3’) ...
-
bioRxiv - Bioengineering 2022Quote: ... DNA products were purified using the DNA Clean & Concentrator-5 Kit (Zymo Research). All purified PCR products were visually checked for expected size via 1% agarose gel electrophoresis and assessed for purity and yield via Nanodrop (Thermo Fisher Scientific).
-
bioRxiv - Genetics 2022Quote: ... PCR products were purified using a Zymo DNA Clean & Concentrator column (Zymo D4003). Size selection was performed on a 8% TBE-urea gel ...
-
bioRxiv - Synthetic Biology 2020Quote: ... PCR products were purified by column with Zymo DCC-5 Kit (Zymo Research), then analyzed on a 0.8% agarose/TE gel ...
-
bioRxiv - Molecular Biology 2020Quote: ... the PCR product was recovered with Zymoclean Gel DNA Recovery Kit (Zymo Research) and sequenced ...
-
bioRxiv - Genomics 2021Quote: ... PCR products were isolated using a DNA Clean and Concentrate Kit (Zymo Research) and quantified using a Qubit fluorometer ...
-
bioRxiv - Cell Biology 2021Quote: ... PCR products were either cleaned up using DNA Clean & Concentrator kits (Zymo Research) or were gel-purified using aGel Purification kit (Zymo Research) ...
-
bioRxiv - Microbiology 2021Quote: ... DNA was extracted with the ZymoBIOMICS 96 DNA Kit (Product D4309) from Zymo Research using the manufacturer’s suggested protocol ...
-
bioRxiv - Microbiology 2020Quote: ... PCR products were purified using the DNA Clean and Concentrator kit (Zymo Research) and used as a template for dsRNA synthesis as previously described 8,31 ...
-
bioRxiv - Synthetic Biology 2023Quote: ... PCR products were column-purified before cloning using DNA Clean & Concentrator (Zymo research).
-
bioRxiv - Microbiology 2023Quote: ... PCR products were pooled and concentrated using DNA Clean and Concentrate columns (Zymo). Insert (sgRNAs ...
-
bioRxiv - Microbiology 2023Quote: ... PCR products were purified using Select-a-size DNA Clear & Concentrator kit (Zymo). Leftover lysate prior to MNase treatment was saved and stored at -80 °C for metagenomic and metatranscriptomic analysis.
-
bioRxiv - Evolutionary Biology 2024Quote: ... PCR products were purified using Zymoclean™ Gel DNA Recovery Kit (Zymo Research) and sequenced by Sanger ...
-
bioRxiv - Evolutionary Biology 2024Quote: ... and the products were purified using the DNA Clean & Concentrator kit (Zymo Research). For the next-generation sequencing (NGS) ...
-
bioRxiv - Synthetic Biology 2024Quote: ... PCR products were purified using the DNA Clean & Concentrator-5 Kit (Zymo Research) or the Zymoclean Gel DNA Extraction Kit (Zymo Research ...
-
bioRxiv - Evolutionary Biology 2023Quote: ... In-vitro transcription products were cleaned using RNA clean & concentrator 25 (Zymo Research) and eluted with 33 µl RNase free water.
-
bioRxiv - Developmental Biology 2022Quote: ... The ligated product was isolated using RNA Clean & Concentrator-5 (Zymo Research, R1016) to retain ≥ 200-nt RNAs and reverse transcribed in 25 μl with 50 pmol RT primer (GCA CCC GAG AAT TCC ANN NNN NNN ...
-
bioRxiv - Molecular Biology 2022Quote: ... PCR products were purified using Zymo DNA Clean and Concentrator kit (Zymo Research), 20 ng of purified PCR products were submitted to Sanger sequencing.
-
bioRxiv - Biochemistry 2023Quote: ... Products were purified with a DNA Clean and Concentrator 5 kit (Zymo Research) and eluted with 6 μl water ...
-
bioRxiv - Genetics 2023Quote: ... the products were purified by an RNA Clean & Concentration-5 kit (Zymo Research), followed by 5′ phosphorylation (39 μl RNA ...
-
bioRxiv - Biophysics 2023Quote: ... PCR products were purified using a commercial DNA purification kit (D4054, Zymo Research) and quantified by A260/A280 absorption using an Infinite M200 Pro plate reader (TECAN) ...
-
bioRxiv - Immunology 2023Quote: ... PCR product/library were purified using DNA Clean and Concentrate-5 (Zymo Research) then ran on a tapestation to visualize nucleosome distribution ...
-
bioRxiv - Biochemistry 2023Quote: ... PCR products were purified using the DNA Clean & Concentrator-5 kit (Zymo Research) and by following the manufacturer’s instructions for dsDNA purification ...
-
bioRxiv - Microbiology 2023Quote: ... PCR products were purified using the ZR Plasmid Miniprep-Classic Kit (Zymo Research), followed by Sanger sequencing using either primer 2235 or 2236.
-
bioRxiv - Molecular Biology 2024Quote: ... The ligated product was isolated using RNA Clean & Concentrator-5 (Zymo Research, R1016) to retain ≥ 200-nt RNAs and reverse transcribed in 25 µl with 50 pmol RT primer (Table S9 ...
-
bioRxiv - Cell Biology 2024Quote: ... The transcribed products were subsequently purified using the RNA Clean & Concentrator (ZYMO RESEARCH). Purified sgRNAs were introduced into HeLa-Cas9 cells by transfection using Lipofectamine RNAiMAX (Life Technologies) ...
-
bioRxiv - Developmental Biology 2024Quote: ... PCR products were purified using the DNA Clean & Concentrator-5 (Zymo Research, D4014) and in vitro transcribed using the MEGAshortscript T7 Transcription Kit (Invitrogen) ...
-
bioRxiv - Biochemistry 2024Quote: ... PCR products were then purified via a DNA Clean & Concentrator 5 column (Zymo) followed by gel purification via an 8% non-denaturing TBE PAGE gel ...
-
bioRxiv - Biochemistry 2024Quote: ... PCR products were purified using the DNA clean & concentrator kit (Zymo Research, D4014) and sequenced by Genewiz ...
-
bioRxiv - Systems Biology 2022Quote: ... the reaction was stopped by adding a DNA binding buffer (Zymo) and purified using a DNA Clean and Concentrate kit (D4004 ...
-
bioRxiv - Bioengineering 2020Quote: ... Transposition reaction was purified with DNA Clean & Concentrator kit (Zymo Research). DNA fragments were PCR-amplified using NEB Q5 MasterMix and custom primers as previously described (Buenrostro et al. ...
-
bioRxiv - Microbiology 2022Quote: ... Gibson reactions were purified with DNA Clean & Concentrator-5 (Zymo Research) and electroporated into DH10b (NEB ...
-
bioRxiv - Molecular Biology 2022Quote: ... The reactions were immediately purified using RNA Clean & Concentrator (Zymo Research) or RNA XP bead (Beckman Coulter).
-
bioRxiv - Microbiology 2022Quote: ... Each reaction was cleaned using DNA clean and concentrator kit (Zymo) and eluted twice with 8 μL H2O ...
-
bioRxiv - Microbiology 2020Quote: ... The reactions were purified via RNA Clean & Concentrator-5 (Zymo Research) and streptavidin pull-down ...
-
bioRxiv - Molecular Biology 2020Quote: ... Reactions were terminated by cleaning with RNA Clean & Concentrator (Zymo Research). Biotin was attached to cross-linked RNA duplexes by incubating with 150 µM Click-IT Biotin sDIBO Alkyne (Life technologies ...
-
bioRxiv - Genetics 2024Quote: ... Each reaction was bound and washed on a silica column (Zymo clean and concentrator kit ...
-
bioRxiv - Biochemistry 2024Quote: ... The reactions were immediately purified using RNA Clean & Concentrator (Zymo Research) or RNA XP bead (Beckman Coulter).
-
bioRxiv - Bioengineering 2024Quote: ... The reactions were then purified with DNA Clean & Concentrator-5 (Zymo) and were eluted by 8 μL of nuclease-free water (Ambion) ...
-
bioRxiv - Bioengineering 2024Quote: ... Pooled reactions were purified (DNA Clean and Concentrator-5 Kit, Zymo), eluted in 6 µL water ...