Labshake search
Citations for Zymo Research :
101 - 150 of 6880 citations for Estrone 3 Sulfate E1S ELISA Kit 5 Plate since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Biochemistry 2022Quote: ... DNA Clean & Concentrator™-5 kit (product # D4014) was purchased from Zymo Research Corp ...
-
bioRxiv - Genetics 2022Quote: ... RNA were purified using RNA Clean & Concentrator-5 Kit (Zymo Research, R1014). Purified RNA were diluted with 1 × IP buffer (150 mM NaCl ...
-
bioRxiv - Genetics 2022Quote: ... RNA were purified using RNA Clean & Concentrator-5 Kit (Zymo Research, R1014). Purified RNA were diluted with 1□× IP buffer (150 mM NaCl ...
-
bioRxiv - Plant Biology 2022Quote: ... PCR products were then purified (Zymo DNA Clean & Concentrator-5 kit, D4013), double-digested with SpeI/SacI ...
-
bioRxiv - Genetics 2022Quote: ... and concentrated using the Zymo DNA Clean & Concetrator-5 kit (Zymo D4004) before injection young adult worms.
-
bioRxiv - Molecular Biology 2023Quote: ... DNA was cleaned by DNA clean and concentrator-5 kit (Zymo, D4014) and sheared by Diagenode Biorupter Pico (EZ mode ...
-
bioRxiv - Genomics 2023Quote: ... RNA was purified using the RNA Clean & Concentrator-5 kit (Zymo, #R1016) according to the manufacturer’s protocol ...
-
bioRxiv - Genomics 2023Quote: ... then purified with Zymo RNA Clean and Concentrator 5 kit (Zymo, R1013) with in-column DNase digestion.
-
bioRxiv - Microbiology 2023Quote: ... DNA was extracted using the Zymo Clean & Concentrator-5 kit (Zymo Research). Samples were sequenced at SeqCenter (Pittsburgh ...
-
bioRxiv - Genomics 2023Quote: ... Libraries were purified with the DNA Clean & Concentrator-5 Kit (Zymo Research) and PCR amplified with barcoded primers (Buenrostro et al. ...
-
bioRxiv - Microbiology 2023Quote: ... followed by clean-up using the RNA Clean & Concentrate Kit-5 (ZYMO). RNA Integrity was determined using RNA screen tape (Agilent ...
-
bioRxiv - Systems Biology 2023Quote: ... and concentrated DNA using a DNA Clean & Concentrator-5 Kit (Zymo, #D4014) with a 30 μL MB H2O elution ...
-
bioRxiv - Neuroscience 2023Quote: ... Products were isolated using DNA Clean and Concentrator-5 kit (Zymo Research) or ...
-
bioRxiv - Systems Biology 2024Quote: ... or the DNA Clean & Concentrator-5 kit (Zymo Research, Irvine, CA, D4013). Reactions were purified with 1.8X Mag-Bind TotalPure NGS magnetic beads (Omega ...
-
bioRxiv - Microbiology 2023Quote: ... and size separated using an RNA Clean & Concentrator-5 Kit (Zymo Research) and treated with 5’-polyphosphatase (Epicenter ...
-
bioRxiv - Plant Biology 2024Quote: ... then purified with the RNA clean and concentrator 5 kit (ZYMO; R1016).
-
bioRxiv - Genetics 2024Quote: ... PCR amplicons were purified using DNA Clean & Concentrator-5 kit (Zymo Research) following the manufacturer’s recommendations ...
-
bioRxiv - Molecular Biology 2024Quote: ... and repurified using a DNA Clean and Concentrator-5 Kit (Zymo #D4004). Next ...
-
bioRxiv - Molecular Biology 2024Quote: ... RNA was purified using an RNA Clean & Concentrator-5 kit (Zymo Research) according to the manufacturer’s protocol ...
-
bioRxiv - Molecular Biology 2024Quote: ... RNA was purified using an RNA Clean & Concentrator-5 kit (Zymo Research) according to the manufacturer’s protocol ...
-
bioRxiv - Molecular Biology 2024Quote: ... RNA was purified with an RNA Clean & Concentrator-5 kit (Zymo Research) according to the manufacturer’s protocol ...
-
bioRxiv - Molecular Biology 2024Quote: ... RNA was purified using an RNA Clean & Concentrator-5 kit (Zymo Research) according to the manufacturer’s protocol ...
-
bioRxiv - Microbiology 2024Quote: ... and RNA Clean and Concentrator-5 Kit (Zymo Research, catalogue number: R1013), respectively ...
-
bioRxiv - Physiology 2022Quote: Total RNA was extracted from larval fat bodies (2-5 pooled/sample) or larval brains (5 pooled/sample) using the Direct-zol RNA MicroPrep kit (Zymo Research). DNAse-treated total RNA (1 µg ...
-
bioRxiv - Genomics 2024Quote: cfDNA was isolated from 5 ml plasma or 5 ml ascites using the Quick-cfDNA Serum & Plasma Kit centrifugation protocol (Zymo Research) for HC ...
-
bioRxiv - Genomics 2024Quote: ... we extracted total RNA from each line (5 wt lines and 5 +0A lines) using the Zymo Direct-Zol RNA extraction kit (Zymo Research). This RNA was immediately reverse transcribed using Superscript III reverse transcriptase (Invitrogen) ...
-
bioRxiv - Microbiology 2019Quote: ... Plasmids were isolated in a 3 mL prep using Zyppy Plasmid Miniprep kit (Zymo Research), and inserts were verified by using Sanger sequencing.
-
bioRxiv - Cell Biology 2023Quote: ... genomic DNA was extracted from ∼3×106 cells by using Quick-DNA Kit (Zymo Research) according to manufacturer’s instructions ...
-
bioRxiv - Genetics 2021Quote: ... We purified reactions using Zymo DNA Clean and Concentrator-5 kit (Zymo D4013) following manufacturer protocols and eluted with 10.5μL water to recover 10μL ...
-
bioRxiv - Developmental Biology 2020Quote: ... and further purified using the RNA Clean & Concentrator-5 kit (Zymo Research, R1013). Samples were treated 30 minutes with TURBO DNase per manufacturer protocol (Thermo Fisher ...
-
bioRxiv - Molecular Biology 2021Quote: ... DNA was purified with a DNA Clean & Concentrator-5 Kit (Zymo Research, D4013) according to the manufacturer’s protocol ...
-
bioRxiv - Molecular Biology 2020Quote: ... The RNA purification was performed using RNA Clean & Concentrator-5 kit (Zymo Research) as described by manufacturer ...
-
bioRxiv - Genomics 2020Quote: ... gDNA fragments were purified using the DNA Clean & Concentrator-5 kit (Zymo Research).
-
bioRxiv - Cancer Biology 2019Quote: ... Transposed DNA was purified using a DNA Clean & Concentrator-5 kit (Zymo Research) in 10 μl nuclease-free H2O and amplified with NEBNext® High-Fidelity 2X PCR Master Mix and 1.25 M of custom Nextera PCR primers as previously described(8) ...
-
bioRxiv - Genetics 2019Quote: ... The fragmented mRNA was purified by RNA Clean & Concentrator-5 kit (ZYMO Research) and eluted into 20 ul RNase-free water ...
-
bioRxiv - Genetics 2020Quote: ... Tagged DNA was purified with the DNA Clean & Concentrator-5 kit (Zymo Research) eluting with 14 µl EB buffer (Qiagen) ...
-
bioRxiv - Cancer Biology 2020Quote: ... The cDNA products were concentrated using cDNA Clean & Concentrator-5 Kit (Zymo Research) followed bead cleanup using 0.6X AMPure XP Beads (Beckman Coulter ...
-
bioRxiv - Synthetic Biology 2021Quote: ... These libraries were purified using the DNA Clean & Concentrator™-5 kit (Zymo) and eluted in water ...
-
bioRxiv - Synthetic Biology 2021Quote: ... The resulting crRNA was purified using RNA Clean & ConcentratorTM-5 kit (Zymo Research), and subsequently quantified using a NanoDrop 2000 spectrophotometer (Thermo Fisher Scientific) ...
-
bioRxiv - Neuroscience 2022Quote: ... the product was purified with the DNA Clean & Concentrator-5 Kit (Zymo Research). 20 μl tagmented DNA was PCR amplified with NEBNext High-Fidelity PCR Master mix and forward and reverse UDI primers ...
-
bioRxiv - Molecular Biology 2022Quote: ... The product was cleaned up using RNA Clean & Concentrator-5 kit (ZYMO, R1013) and added into 20 μl of reverse transcription and strand-switching reaction containing 100 nM custom primer (5’ - phos/ ACTTGCCTGTCGCTCTATCTTCATTGATGGTGCCTACAG - 3’) ...
-
bioRxiv - Molecular Biology 2022Quote: ... rRNA-depleted RNA was purified by RNA Clean & Concentrator-5 kit (ZYMO, R1013) and then ligated to 50 pmol 3’ adapter (5’-rAppCTGTAGGCACCATCAAT - NH2-3’ ...
-
bioRxiv - Bioengineering 2022Quote: ... DNA products were purified using the DNA Clean & Concentrator-5 Kit (Zymo Research). All purified PCR products were visually checked for expected size via 1% agarose gel electrophoresis and assessed for purity and yield via Nanodrop (Thermo Fisher Scientific).
-
bioRxiv - Microbiology 2020Quote: ... and subsequently purified using the RNA Clean and Concentrate −5 kit (Zymo Research). RNA was then prepped for deep-sequencing using the TruSeq Stranded mRNA Library Preparation Kit (Illumina ...
-
bioRxiv - Microbiology 2022Quote: ... the RNA was purified using the RNA Clean & Concentrator-5 kit (Zymo Research). The 3’ barcoded adaptors were ligated onto the RNA by mixing 5 µl of the dephosphorylated RNA with 100 µM of the barcoded adaptor and heating for 2 min at 70°C before transfer to ice ...
-
bioRxiv - Biochemistry 2022Quote: ... followed by column purification using RNA Clean & Concentrator Kit-5 (R1015, Zymo Research). End-repaired RPFs RNA were eluted in 20 µL of nuclease-free water ...
-
bioRxiv - Microbiology 2022Quote: ... After reaction clean-up using ZYMO RNA Clean & Concentrator-5 kit (ZYMO, R1013), 5’ triphosphates were removed enzymatically ...
-
bioRxiv - Molecular Biology 2019Quote: ... The transcribed RNAs were purified using RNA Clean & Concentrator-5 kit (Zymo Research) and quantified by absorbance.
-
bioRxiv - Synthetic Biology 2020Quote: ... PCR products were purified by column with Zymo DCC-5 Kit (Zymo Research), then analyzed on a 0.8% agarose/TE gel ...
-
bioRxiv - Immunology 2020Quote: ... DNA was purified using the DNA Clean and Concentrator-5 kit (Zymo Research) and barcoding was performed using Illumina compatible index primers designed according to Buenrostro et al ...