Labshake search
Citations for Zymo Research :
101 - 150 of 6398 citations for Atrial Natriuretic Peptide ANP ELISA Kit 5 Plate since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Genomics 2024Quote: ... we extracted total RNA from each line (5 wt lines and 5 +0A lines) using the Zymo Direct-Zol RNA extraction kit (Zymo Research). This RNA was immediately reverse transcribed using Superscript III reverse transcriptase (Invitrogen) ...
-
bioRxiv - Genetics 2021Quote: ... We purified reactions using Zymo DNA Clean and Concentrator-5 kit (Zymo D4013) following manufacturer protocols and eluted with 10.5μL water to recover 10μL ...
-
bioRxiv - Developmental Biology 2020Quote: ... and further purified using the RNA Clean & Concentrator-5 kit (Zymo Research, R1013). Samples were treated 30 minutes with TURBO DNase per manufacturer protocol (Thermo Fisher ...
-
bioRxiv - Molecular Biology 2021Quote: ... DNA was purified with a DNA Clean & Concentrator-5 Kit (Zymo Research, D4013) according to the manufacturer’s protocol ...
-
bioRxiv - Molecular Biology 2020Quote: ... The RNA purification was performed using RNA Clean & Concentrator-5 kit (Zymo Research) as described by manufacturer ...
-
bioRxiv - Genomics 2020Quote: ... gDNA fragments were purified using the DNA Clean & Concentrator-5 kit (Zymo Research).
-
bioRxiv - Cancer Biology 2019Quote: ... Transposed DNA was purified using a DNA Clean & Concentrator-5 kit (Zymo Research) in 10 μl nuclease-free H2O and amplified with NEBNext® High-Fidelity 2X PCR Master Mix and 1.25 M of custom Nextera PCR primers as previously described(8) ...
-
bioRxiv - Genetics 2019Quote: ... The fragmented mRNA was purified by RNA Clean & Concentrator-5 kit (ZYMO Research) and eluted into 20 ul RNase-free water ...
-
bioRxiv - Genetics 2020Quote: ... Tagged DNA was purified with the DNA Clean & Concentrator-5 kit (Zymo Research) eluting with 14 µl EB buffer (Qiagen) ...
-
bioRxiv - Cancer Biology 2020Quote: ... The cDNA products were concentrated using cDNA Clean & Concentrator-5 Kit (Zymo Research) followed bead cleanup using 0.6X AMPure XP Beads (Beckman Coulter ...
-
bioRxiv - Synthetic Biology 2021Quote: ... These libraries were purified using the DNA Clean & Concentrator™-5 kit (Zymo) and eluted in water ...
-
bioRxiv - Synthetic Biology 2021Quote: ... The resulting crRNA was purified using RNA Clean & ConcentratorTM-5 kit (Zymo Research), and subsequently quantified using a NanoDrop 2000 spectrophotometer (Thermo Fisher Scientific) ...
-
bioRxiv - Neuroscience 2022Quote: ... the product was purified with the DNA Clean & Concentrator-5 Kit (Zymo Research). 20 μl tagmented DNA was PCR amplified with NEBNext High-Fidelity PCR Master mix and forward and reverse UDI primers ...
-
bioRxiv - Molecular Biology 2022Quote: ... The product was cleaned up using RNA Clean & Concentrator-5 kit (ZYMO, R1013) and added into 20 μl of reverse transcription and strand-switching reaction containing 100 nM custom primer (5’ - phos/ ACTTGCCTGTCGCTCTATCTTCATTGATGGTGCCTACAG - 3’) ...
-
bioRxiv - Molecular Biology 2022Quote: ... rRNA-depleted RNA was purified by RNA Clean & Concentrator-5 kit (ZYMO, R1013) and then ligated to 50 pmol 3’ adapter (5’-rAppCTGTAGGCACCATCAAT - NH2-3’ ...
-
bioRxiv - Bioengineering 2022Quote: ... DNA products were purified using the DNA Clean & Concentrator-5 Kit (Zymo Research). All purified PCR products were visually checked for expected size via 1% agarose gel electrophoresis and assessed for purity and yield via Nanodrop (Thermo Fisher Scientific).
-
bioRxiv - Microbiology 2020Quote: ... and subsequently purified using the RNA Clean and Concentrate −5 kit (Zymo Research). RNA was then prepped for deep-sequencing using the TruSeq Stranded mRNA Library Preparation Kit (Illumina ...
-
bioRxiv - Microbiology 2022Quote: ... the RNA was purified using the RNA Clean & Concentrator-5 kit (Zymo Research). The 3’ barcoded adaptors were ligated onto the RNA by mixing 5 µl of the dephosphorylated RNA with 100 µM of the barcoded adaptor and heating for 2 min at 70°C before transfer to ice ...
-
bioRxiv - Biochemistry 2022Quote: ... followed by column purification using RNA Clean & Concentrator Kit-5 (R1015, Zymo Research). End-repaired RPFs RNA were eluted in 20 µL of nuclease-free water ...
-
bioRxiv - Microbiology 2022Quote: ... After reaction clean-up using ZYMO RNA Clean & Concentrator-5 kit (ZYMO, R1013), 5’ triphosphates were removed enzymatically ...
-
bioRxiv - Molecular Biology 2019Quote: ... The transcribed RNAs were purified using RNA Clean & Concentrator-5 kit (Zymo Research) and quantified by absorbance.
-
bioRxiv - Synthetic Biology 2020Quote: ... PCR products were purified by column with Zymo DCC-5 Kit (Zymo Research), then analyzed on a 0.8% agarose/TE gel ...
-
bioRxiv - Immunology 2020Quote: ... DNA was purified using the DNA Clean and Concentrator-5 kit (Zymo Research) and barcoding was performed using Illumina compatible index primers designed according to Buenrostro et al ...
-
bioRxiv - Genetics 2020Quote: ... and purified by RNA clean and concentrator-5 kit (Zymo Research, CA, USA) according to the manufacturer’s instructions ...
-
bioRxiv - Evolutionary Biology 2021Quote: ... followed by RNA purification with the RNA Clean & Concentrator-5 kit (Zymo Research) according to the manufacturer’s protocol ...
-
bioRxiv - Genomics 2020Quote: ... The RNA was isolated using the RNA Clean & Concentrator-5 Kit (R1013, Zymo) according to manufacturer’s instructions.
-
bioRxiv - Evolutionary Biology 2020Quote: ... sgRNAs were purified using an RNA Clean and Concentrator 5 kit (Zymo Research), eluted with nuclease-free water ...
-
bioRxiv - Genomics 2020Quote: ... and purified the reaction using the DNA Clean and Concentrator-5 kit (Zymo).
-
bioRxiv - Molecular Biology 2020Quote: ... RNA was then purified using the RNA Clean & Concentrator-5 Kit (Zymo Research), according to manufacturer’s instructions ...
-
bioRxiv - Genomics 2022Quote: ... Amplified DNA was cleaned up using a Clean & Concentrator-5 kit (D4013, Zymo) and then digested with 1 μl BsrDI (R0574S ...
-
bioRxiv - Bioengineering 2022Quote: ... With RNA pre-cleaned using the RNA clean-and-concentrator-5 kit (Zymo), and denatured by addition of 1x RNA loading dye (NEB ...
-
bioRxiv - Developmental Biology 2022Quote: ... Transposed DNA was purified using the Zymo Clean and Concentrator-5 kit (Zymo) according to the manufacturer’s protocol and eluted in 21ml of elution buffer ...
-
bioRxiv - Molecular Biology 2022Quote: ... The RNA was purified using an RNA Clean & Concentrator-5 Kit (Zymo Research) and eluted into 10 µL H2O.
-
bioRxiv - Microbiology 2022Quote: ... DNA was purified using the DNA Clean and Concentrator-5 kit (Zymo Research), according to the manufacturer’s instructions ...
-
bioRxiv - Molecular Biology 2022Quote: ... RNA was purified using the RNA Clean & Concentrator-5 Kit (Zymo Research, R1015). 1 ug of RNA was denatured at 95°C for 1 minute and subsequently refolded by incubating in 340mM sodium cacodylate buffer (Electron Microscopy Sciences ...
-
bioRxiv - Systems Biology 2023Quote: ... We performed gel extraction using the DNA Clean & Concentrator-5 Kit (Zymo, #D4014) and eluted in 20 μL MB H2O ...
-
bioRxiv - Molecular Biology 2023Quote: ... and purified with the DNA Clean and Concentrator kit (DCC-5, Zymo Research) to rid of any traces of primers and free adapters ...
-
bioRxiv - Genomics 2023Quote: ... DNA fragments were purified using the DNA Clean & Concentrator-5 Kit (Zymo, D4014) according to the manufacturer’s procedures ...
-
bioRxiv - Cell Biology 2023Quote: ... Transposed DNA was purified using a DNA Clean & Concentrator-5 kit (Zymo Research) in 10 µl nuclease-free H2O and amplified with NEBNext® High-Fidelity 2X PCR Master Mix and 1 ul of primer pair from Diagenode (24 SI for tagmented libraries ...
-
bioRxiv - Biophysics 2023Quote: ... The cDNA was purified using Zymo oligo clean and concentrator-5 kit (Zymo). To prepare dsDNA for sequencing ...
-
bioRxiv - Microbiology 2023Quote: ... Ribo-depleted RNA was concentrated using the RNA Clean & Concentrate Kit-5 (ZYMO), and integrity and concentrations of the ribo-depleted RNA checked using a High sensitivity RNA Tape (Agilent ...
-
bioRxiv - Genomics 2023Quote: ... DNA was extracted with the DNA Clean and Concentrator-5 Kit (Zymo Research). Sequencing adapters were attached to the transposed DNA fragments using NEBNext Ultra II Q5 PCR mix (New England Biolabs) ...
-
bioRxiv - Genomics 2023Quote: ... and clean up with the ChIP DNA Clean & Concentrator-5 kit (Zymo, D5205). DNA was quantified by Qubit dsDNA high sensitivity kit ...
-
bioRxiv - Genomics 2023Quote: ... and then cleaned up with the DNA Clean & Concentrator-5 kit (Zymo, D4013) and eluted in 21 ul 10 mM Tris-HCl pH 8 ...
-
bioRxiv - Biochemistry 2023Quote: ... Products were purified with a DNA Clean and Concentrator 5 kit (Zymo Research) and eluted with 6 μl water ...
-
bioRxiv - Genetics 2023Quote: ... the products were purified by an RNA Clean & Concentration-5 kit (Zymo Research), followed by 5′ phosphorylation (39 μl RNA ...
-
bioRxiv - Biophysics 2023Quote: ... The modified RNA was purified using RNA Clean and Concentrator-5 kit (Zymo) according to manufacturer’s instructions.
-
bioRxiv - Cancer Biology 2023Quote: ... Tagged DNA fragments were purified using the Clean & Concentrator-5 Kit (ZYMO, D4014), then subjected to PCR amplification and double-sided bead purification (to remove primer dimers and larger than 1,000 bp fragments ...
-
bioRxiv - Systems Biology 2023Quote: ... We extracted the band using a DNA Clean & Concentrator-5 Kit (Zymo, #D4014), eluted in 30 μL MB H2O ...
-
bioRxiv - Molecular Biology 2023Quote: ... Polyadenylated mRNA was purified using the RNA Clean & Concentrator-5 kit (Zymo Research) according to the manufacturer’s instructions.