Labshake search
Citations for Zymo Research :
51 - 100 of 6208 citations for Rat TGF beta 1 ELISA Kit since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Developmental Biology 2024Quote: ... The DNA was digested with 0.5 mg/ml Proteinase K for 1 hour at 65°C and then purified using the ChIP DNA Clean & Concentrator kit (Zymo) and quantified with QUBIT ...
-
bioRxiv - Microbiology 2022Quote: ... Gel extraction kit and DNA purification kit were from Zymo Research ...
-
bioRxiv - Genomics 2020Quote: ... DNA was then extracted from approximately 1 ml of the red blood cell pellets using Zymo Bead Genomic DNA kit (Zymo Research) following the manufacturer’s procedures ...
-
bioRxiv - Plant Biology 2019Quote: ... RNA was isolated from Tak-1 and Tak-2 whole-plant material using the Direct-Zol RNA Mini-Preparation Kit (Zymo Research). cDNA synthesis was carried out using the RevertAid H Minus First Strand cDNA Synthesis Kit (Thermo Fisher Scientific ...
-
bioRxiv - Microbiology 2020Quote: ... The Variovorax CL14 genes contained in Vectors 1 and 2 were inferred by isolating plasmid from these clones using the ZymoPURE II Plasmid Midiprep Kit (Zymo Research) and Sanger sequencing the insert ends using primers JMC247 and JMC270 (Supplementary Table 19) ...
-
bioRxiv - Biochemistry 2021Quote: ... The PCR products were subjected to 1% agarose gel electrophoresis and they were purified using a Zymogen gel DNA recovery kit (Zymo Research). The assembly reactions were transformed to chemically competent E ...
-
bioRxiv - Cancer Biology 2021Quote: Genomic DNA was extracted from GBM-DCs and TRA-1-81+/SSEA4+ ic-GSCs using the Quick-DNA Microprep Kit (D-3020, Zymo Research). Bisulfite conversion ...
-
bioRxiv - Microbiology 2020Quote: ... genomic DNA was extracted from 1 ml breastmilk using Quick-DNA Fungal/Bacterial extraction kit following the manufacturer’s instructions (Zymo Research, USA). Extraction kits were purchased separately for Batch 1 and Batch 2 ...
-
bioRxiv - Cancer Biology 2022Quote: RNA was isolated from 10 cm plates of SKMEL5 cells with 3 biological replicates per condition (DMSO, 100 nM binimetinib, 1 μM binimetinib) using Direct-zol RNA miniprep kit (Zymo Research), as previously described (24) ...
-
bioRxiv - Molecular Biology 2019Quote: Cells were infected with 1 MOI of TB40/EGFP and RNA was isolated using Quick-DNA/RNA miniprep kit (Zymo Research) from 0-72 hpi ...
-
bioRxiv - Microbiology 2020Quote: ... DNA was extracted from CEM-SS or Tet-inducible HTLV-1 Tax CEM-SS cells that were infected with DNaseI-treated WT or IN- HIV-1 at 2dpi using a DNA Miniprep Plus kit (Zymo Research). Purified DNA was then digested with MscI ...
-
bioRxiv - Molecular Biology 2021Quote: ... Reactions were incubated for 1 hour at 37 °C and DNA was purified using the DNA Clean & Concentrator-25 kit (Zymo Research) as described by the manufacturer.
-
bioRxiv - Plant Biology 2020Quote: ... ToMVMP-ToBRFV or ToMVMP-ToBRFV(1-216) were linearized with SmaI and cleaned by Gel extraction kit (Zymo Research, ZR-D4002). In vitro transcription using the mMESSAGE mMACHINE™ T7 kit (Invitrogen by Thermo Fisher Scientific ...
-
bioRxiv - Genetics 2020Quote: ... 100 mg of thawed cell pellets were washed three times in 1 mL deionized water and extracted using Quick-DNA Fungal/Bacterial Miniprep kit (Zymo Research). A total of 2.4 μg of purified gDNA was fragmented by sonication to average size of ~350 bp in four separate aliquots using a Diagenode Picoruptor ...
-
bioRxiv - Microbiology 2022Quote: ~1 kb products from the Pan-Entamoeba PCR above were gel purified using a Zymoclean Gel DNA Recovery Kit (Zymo Research) and submitted to the UW-Madison Biotechnology Center for Sanger Sequencing using the amplification primers described above ...
-
bioRxiv - Microbiology 2023Quote: Cells were infected with 1 MOI of TB40/EGFP and DNA and RNA was isolated using Quick-DNA/RNA miniprep kit (Zymo Research) from 0–72 hpi ...
-
bioRxiv - Genomics 2023Quote: Total RNA (∼1 µg) was used to make RNA-seq libraries following the Zymo-Seq Ribo-free Total RNA Library Kit (Zymo Research) instructions with dual indexing ...
-
bioRxiv - Genomics 2023Quote: ... RNA was extracted from each well of a 6-well plate containing ES or DE cells using 1 mL Tripure and the Direct-Zol RNA Extraction kit (Zymo Research) according to the manufacturer’s instructions ...
-
bioRxiv - Genomics 2023Quote: gDNA was isolated from ∼25 mg of frozen tissue or ∼1 x 106 HepG2 cells suspended in 200 µL of PBS using the Quick-DNA Miniprep Plus kit (Zymo Research) following the manufacturer’s protocol with an overnight (for frozen tissue ...
-
bioRxiv - Cancer Biology 2023Quote: ... Modifications to the published method are the following: 1) extraction of RNA prior to cDNA reverse transcription with the Zymo Direct-zol-96 RNA isolation kit (Zymo, #R0256) 2 ...
-
bioRxiv - Genetics 2023Quote: ... followed by resuspension of ~200k to 1 million cells in 300ul RNA Lysis Buffer from the Quick-RNA Miniprep Kit (Zymo R1055) and stored in −70deg ...
-
bioRxiv - Molecular Biology 2024Quote: ... in 1× RNase H buffer overnight at 37 °C before immunoprecipitation and recovered using the Oligo Clean & Concentrator kit (Zymo Research). For m1A-DIP ...
-
bioRxiv - Bioengineering 2024Quote: Up to 1 × 108 yeast cells from a growing culture were taken to perform a zymoprep using the ZymoprepII kit (D2004, Zymo Research). The TRACeR sequences were amplified from the extracted plasmids and the adapter sequences were added by PCR ...
-
bioRxiv - Genetics 2024Quote: ... at 37°C for 1 hr and purified again by illustra microspin G-50 column or Direct-zol RNA Miniprep kits (Zymo Research) before transfection (Supplemental Fig ...
-
bioRxiv - Genetics 2024Quote: ... DNA from a minimum of 1 e-6 cells from each fraction was isolated using the YeaStar Genomic DNA Kit (Zymo Research). DNA was fragmented by sonication and sequenced.
-
bioRxiv - Cell Biology 2019Quote: RNA was isolated using a commercial kit (RNAmicro kit, Zymo Research), according to the manufacturer’s instructions ...
-
bioRxiv - Genetics 2021Quote: DNA bisulfite conversion was performed directly starting from cell pellets (a maximum of 1×105 cells per sample) using the EZ DNA Methylation-Direct kit (Zymo Research #D5021) following the manufacturer’s instructions ...
-
bioRxiv - Immunology 2019Quote: ... PCR products were applied to 1% agarose DNA gel electrophoresis and gel-purified with Zymoclean™ Gel DNA Recovery Kit (Zymo Research) according to the manufacturer’s instructions ...
-
bioRxiv - Neuroscience 2020Quote: RNA was isolated from three biological replicates of E/I networks composed of Ngn2 #2 and Ascl1 #1 (DIV 49) with the Quick-RNA Microprep kit (Zymo Research, R1051) according to manufacturer’s instructions ...
-
bioRxiv - Physiology 2022Quote: Total RNA from adipose tissues (experiment 1) was extracted using the Direct-zol™ RNA MiniPrep Plus kit protocol (Zymo research, #R2071). RNA was reverse-transcribed using the SuperScript™ III Reverse Transcriptase Kit (ThermoFisher ...
-
bioRxiv - Pharmacology and Toxicology 2021Quote: ... Genomic DNA (1 μg) was treated with sodium bisulfite using the EZ DNA Methylation Gold Kit per manufacturer’s instructions (Zymo Research; Irvina, CA). Bisulfite converted DNA (∼20 ng ...
-
bioRxiv - Immunology 2021Quote: ... PCR products were subjected to 1% agarose DNA gel electrophoresis and gel-purified with Zymoclean™ Gel DNA Recovery Kit (Zymo Research) according to the manufacturer’s instructions ...
-
bioRxiv - Synthetic Biology 2022Quote: DNA bisulfite conversion was performed starting from a maximum of 1 × 105 pelleted cells per sample using the EZ DNA Methylation-Direct kit (Zymo Research #D5021), and following the manufacturer’s instructions ...
-
bioRxiv - Biochemistry 2023Quote: ... Single colonies were grown in Sc-Ura medium for 1 d and plasmid DNA was purified using Zymoprep II Yeast plasmid Miniprep kit (Zymo Research, CA). Plasmids were then transformed into E ...
-
bioRxiv - Plant Biology 2023Quote: ... The adapter-ligated DNA molecules were purified using 1× Agencourt AMPure XP magnetic beads and were subjected to bisulfite conversion using ZYMO EZ DNA Methylation-Gold Kit (Zymo, Cat. #D5005). Libraries were then amplified by PCR using 20 μL of bisulfite-converted DNA molecules ...
-
bioRxiv - Molecular Biology 2023Quote: ... at 37°C for 1 h and further cleaned up by using a Zymo RNA Clean and Concentrator-5 purification kit (Zymo Research, R1016). All the oligos used in the library preparation are noted in Supplementary Table 6a.
-
bioRxiv - Microbiology 2024Quote: ... The amplified promoter and coding PIGJ DNA sequence were first purified from 1% agarose gels using the ZymocleanTM Gel DNA recovery kit (Zymo Research, #D4007) and assembled in frame into the digested pLIC-HA -DHFR-TS plasmid in frame with the 3x HA tag using the NEBuilder HiFi DNA Assembly cloning Kit (NEB ...
-
bioRxiv - Genomics 2023Quote: ... Plasmid is extracted from the bacterial culture using a 96-well mini-prep kit (Zymo kit, Zippy 96 plasmid kit). All clones are sequenced by Sanger sequencing at the site of the barcode using primer ACTTGTGTAGCGCCAAGTGC ...
-
bioRxiv - Genetics 2019Quote: ... and gel extraction kit (Zymoclean Gel DNA Recovery Kit) were from Zymo Research ...
-
bioRxiv - Bioengineering 2022Quote: ... using a commercial kit (ZymoPURE II Plasmid Maxiprep Kit; Zymo Research Corp). HEK293Ta cells (Genecopoeia ...
-
bioRxiv - Biophysics 2021Quote: ... Plasmids used for nucleofections were purified by Zymo midiprep kit (Zymo D4200) and concentrations were quantified by absorption at 260 nm ...
-
bioRxiv - Synthetic Biology 2023Quote: ... coli Transformation Kit (Zymo).
-
bioRxiv - Biophysics 2023Quote: ... Plasmids were purified by Zymo midiprep kit (Zymo D4200) and all cloning was confirmed by Sanger sequencing ...
-
bioRxiv - Microbiology 2023Quote: ... coli Transformation Kit (Zymo).
-
bioRxiv - Molecular Biology 2022Quote: ... the aqueous phase was diluted back in TRizol reagent (1:3) to proceed with RNA purification by zymodirect RNA kit (Zymo research, cat. R2051). The quality of RNA samples was assessed using Agilent 2200 TapeStation (Agilent Technologies ...
-
bioRxiv - Microbiology 2022Quote: ... PCR products were separated by electrophoresis on a 1% agarose gel and purified using the Zymoclean Gel DNA recovery Kit (Zymo Research, Irvine, CA). The purified DNA fragments were then submitted for Sanger sequencing (GENEWIZ ...
-
bioRxiv - Plant Biology 2022Quote: ... Fragments were resolved with gel electrophoresis (1% agarose in 1x TAE buffer) and excised using the Zymoclean Gel DNA Recovery Kit (Zymo Research; Ref.: D4008) for elution of high-concentration ultra-pure DNA ...
-
bioRxiv - Molecular Biology 2022Quote: ... Two-third of final flag elute was taken for DNase treatment using NEB DNase 1 (M0303) and RNA was purified using RNA Clean and Concentrator Kit (Zymo Research, R1015/R1017). The final RNA concentration was determined using Qubit RNA high Sensitivity Assay Kit and 100ng of RIP-purified RNA was used for cDNA library preparation using NEBNext Ultra II directional RNA library kit (NEB ...
-
bioRxiv - Cancer Biology 2022Quote: ... The outer PCR products amplified using primer #1 and #2 were purified and concentrated using the DNA Clean and Concentrator 5 kit (Zymo Research, Orange, CA) and eluted in 20ul of TE buffer ...
-
bioRxiv - Evolutionary Biology 2023Quote: PCR products were visualized by agarose gel (1%) electrophoresis then extracted and purified using Zymoclean Gel DNA Recovery Kit (Zymo Research Lot. #213587) following manufacturer protocols ...