Labshake search
Citations for Zymo Research :
51 - 100 of 6074 citations for Rat Insulin Like 3 INSL3 CLIA Kit since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Developmental Biology 2022Quote: ... GATA-3 and RORC were generated by PCR with ZymoTaq PCR Master Mix (Zymo Research) using the primers listed in Table 1 ...
-
bioRxiv - Microbiology 2022Quote: ... samples were homogenized 3:1 weight:volume in DNA/RNA Shield® (Zymo® Research Inc.).
-
bioRxiv - Cell Biology 2023Quote: ... After 3 h of growth cells were arrested with 25 μM α-factor (Zymo Research) for 3 h ...
-
bioRxiv - Microbiology 2022Quote: ... Gel extraction kit and DNA purification kit were from Zymo Research ...
-
bioRxiv - Developmental Biology 2021Quote: ... 3 and 4 by lysing cells in the 6-well plate in RNA lysis buffer (Zymo) and freezing at −80 °C until extraction ...
-
bioRxiv - Synthetic Biology 2022Quote: ... at a ratio of 1:3 (DNA : Zymo Shield / 20 µl DNA:60 µl Zymo Shield). O volume of 5µl of the PCR product was loaded on a gel for confirmation of the reaction ...
-
bioRxiv - Synthetic Biology 2022Quote: ... at a ratio of 1:3 (DNA : Zymo Shield / 20 µl DNA:60 µl Zymo Shield). O volume of 5µl of the PCR product was loaded on a gel for confirmation of the reaction ...
-
bioRxiv - Cell Biology 2019Quote: RNA was isolated using a commercial kit (RNAmicro kit, Zymo Research), according to the manufacturer’s instructions ...
-
bioRxiv - Genomics 2023Quote: ... Plasmid is extracted from the bacterial culture using a 96-well mini-prep kit (Zymo kit, Zippy 96 plasmid kit). All clones are sequenced by Sanger sequencing at the site of the barcode using primer ACTTGTGTAGCGCCAAGTGC ...
-
bioRxiv - Genetics 2019Quote: ... and gel extraction kit (Zymoclean Gel DNA Recovery Kit) were from Zymo Research ...
-
bioRxiv - Bioengineering 2022Quote: ... using a commercial kit (ZymoPURE II Plasmid Maxiprep Kit; Zymo Research Corp). HEK293Ta cells (Genecopoeia ...
-
bioRxiv - Cancer Biology 2021Quote: ... 3 aliquots were collected in 1 ml stabilization buffer tubes (DNA/RNA Shield, Zymo Research, Irvine, California) using sterile swabs ...
-
bioRxiv - Biophysics 2021Quote: ... Plasmids used for nucleofections were purified by Zymo midiprep kit (Zymo D4200) and concentrations were quantified by absorption at 260 nm ...
-
bioRxiv - Synthetic Biology 2023Quote: ... coli Transformation Kit (Zymo).
-
bioRxiv - Biophysics 2023Quote: ... Plasmids were purified by Zymo midiprep kit (Zymo D4200) and all cloning was confirmed by Sanger sequencing ...
-
bioRxiv - Microbiology 2023Quote: ... coli Transformation Kit (Zymo).
-
bioRxiv - Molecular Biology 2022Quote: ... ZymoPure Plasmid Midiprep kit and RNA Clean & Concentrator kit were purchased from Zymo Research ...
-
bioRxiv - Microbiology 2023Quote: ... RNA was isolated using a commercial kit (DirectZol RNA Miniprep kit, Zymo Research) following manufacturer instructions ...
-
bioRxiv - Biochemistry 2023Quote: ... ZymoPURE II Midiprep Kit or the ZymoPURE II Maxiprep Kit (all Zymo Research).
-
bioRxiv - Immunology 2023Quote: ... the RNeasy Plus kit (specifically, the Quick RNA miniprep plus kit, Zymo, USA) was utilized and RNA was quantitated with Qubit RNA HS (High Sensitivity ...
-
bioRxiv - Animal Behavior and Cognition 2021Quote: ... We then lysed 3 dpf larvae individually by rigorously pipetting in 55 μl DNA/RNA Shield (Zymo Research) at RT followed by overnight incubation at 4°C ...
-
bioRxiv - Molecular Biology 2023Quote: ... Infectious viral stocks were inactivated by a 1:3 dilution with TRI Reagent® (Zymo, R2050-1-200) immediately prior to RNA extraction ...
-
bioRxiv - Molecular Biology 2023Quote: ... DNA and RNA were extracted using commercial kits: Quick-DNA-fungal/bacterial MiniPrep™ kit (ZymoResearch) was used for DNA and Quick-RNA-fungal/bacterial MiniPrep™ kit (Zymo Research) was used for RNA ...
-
bioRxiv - Synthetic Biology 2022Quote: ... coli using GeneJet plasmid miniprep kit (ThermoScientific) or ZymoPURE plasmid midiprep kit (Zymo Research). Sequences of all plasmids were confirmed using Sanger sequencing performed by Eurofins Genomics ...
-
bioRxiv - Microbiology 2023Quote: ... coli using GeneJet plasmid miniprep kit (ThermoScientific) or ZymoPURE plasmid midiprep kit (Zymo Research). Sequences of all plasmids were confirmed using Sanger sequencing performed by Eurofins Genomics ...
-
bioRxiv - Microbiology 2024Quote: ... The three PCR fragments were purified (Zymo DNA Clean and Concentrator kit: ‘Zymo kit’) and used in a 1:1:1 molar ratio Golden Gate assembly reaction with BsaI (NEB ...
-
bioRxiv - Microbiology 2021Quote: ... coli transformation kit (Zymo Research) or standard electro-transformation protocols ...
-
bioRxiv - Neuroscience 2020Quote: ... or MiniPrep Kit (R2052, Zymo Research ...
-
bioRxiv - Synthetic Biology 2020Quote: ... coli Transformation Kit (Zymo Research).
-
bioRxiv - Synthetic Biology 2021Quote: ... coli Transformation Kit from Zymo Research (Irvine ...
-
bioRxiv - Genomics 2021Quote: ... the RCC kit (Zymo Research).
-
bioRxiv - Developmental Biology 2020Quote: ... or Quick-RNA kit (Zymo). Reverse transcription was carried out by using the High-Capacity RNA-to-cDNA Kit (ThermoFisher) ...
-
bioRxiv - Synthetic Biology 2023Quote: ... coli Transformation Kit (Zymo Research). For each transformation ...
-
bioRxiv - Developmental Biology 2023Quote: ... and RNA purification kit (Zymo). cDNA was generated using Maxima First Strand cDNA synthesis kit (Thermo Fisher Scientific) ...
-
bioRxiv - Genetics 2023Quote: ... ZymoPure Midiprep Kit (Zymo Research) was used to prepare donor constructs for embryo injection ...
-
bioRxiv - Microbiology 2024Quote: ... Correct amplicons were isolated by Zymo PCR purification kit (Zymo Research). The PCR products were cloned into a PCR linearized pEcgRNA-guide plasmid to make the pEcgRNA-guide-RT plasmid using In-fusion® HD-cloning kit (Takara Bio ...
-
bioRxiv - Synthetic Biology 2024Quote: ... coli Transformation Kit (Zymo Research), and transformations were carried out using 50 ng of ligation product or plasmid ...
-
bioRxiv - Cancer Biology 2024Quote: ... coli Transformation Kit (Zymo Research). Plasmids were prepared following standard protocols ...
-
bioRxiv - Systems Biology 2023Quote: ... 3 μl of reaction mix were transformed into Mix & Go! Competent Cells - DH5 Alpha (Zymo Research Corporation, Irvine, CA). Correct assembly was checked by colony PCR followed by Sanger sequencing of the gene fragment region and the Gibson junctions ...
-
bioRxiv - Biochemistry 2021Quote: ... Zyppy™ Plasmid Miniprep kit and DNA Clean & Concentrator™ kit were purchased from Zymo Research ...
-
bioRxiv - Developmental Biology 2020Quote: ... Total RNA was isolated from using DNA/RNA Duet Kit miniprep kit (Zymo Research, USA).
-
bioRxiv - Genetics 2022Quote: ... cerevisiae temperature-sensitive strain TSA64 en masse using EZ Kit Yeast Transformation kit (Zymo Research). The entire transformed library was grown in selective media (YPD + clonNAT ...
-
bioRxiv - Genetics 2024Quote: ... cerevisiae double mutant strain sml1Δ rad53Δ using the EZ Kit Yeast Transformation kit (Zymo Research) to obtain ∼1,000,000 clones per region ...
-
bioRxiv - Molecular Biology 2021Quote: ... 10 μl RNA from total or immunopurified ribosomes were 3’ dephosphorylated and 5’ phosphorylated as described above 30 and was selectively recovered with RNA Clean and Concentrator-5 (Zymo) according to the manufacturer’s instructions ...
-
bioRxiv - Genetics 2022Quote: Yeast colonies containing bait and prey constructs that grew on Trp−/Leu−/His− + 25 mM 3-Amino-1,2,4-triazole (3AT) selection plates were extracted using the Zymoprep Yeast Plasmid Miniprep II (Zymo Research, D2004) followed by Sanger sequencing for gene identification ...
-
Evolution of protease activation and specificity via alpha-2-macroglobulin-mediated covalent capturebioRxiv - Synthetic Biology 2023Quote: DNA libraries for Nanopore sequencing were prepared by extracting plasmid DNA from ~1 × 109 cells (input library, 30 ml culture) or ~3 × 107 cells (output populations, 1 ml culture) using Zymoprep Yeast Plasmid Miniprep (Zymo). One freeze-thaw cycle (at −80°C ...
-
bioRxiv - Synthetic Biology 2022Quote: ... whereas Zymoclean Gel DNA Recovery Kit and Zymoprep Yeast Plasmid Miniprep Kits were purchased from Zymo Research (Irvine ...
-
bioRxiv - Microbiology 2019Quote: ... DNA was extracted using a ‘Quick-DNA™’ Fungal/Bacterial 96 kit extraction kit (Zymo Research). A Nextera DNA library preparation kit (Illumina ...
-
bioRxiv - Synthetic Biology 2023Quote: ... and Zymoclean Gel DNA Recovery Kit and Zymoprep Yeast Plasmid Miniprep Kits were purchased from Zymo Research (Irvine ...
-
bioRxiv - Neuroscience 2023Quote: ... and total RNA was isolated by using a commercial kit (RNA Clean & Concentrator kits, ZYMO Research). Total RNA (500 ng each ...