Labshake search
Citations for Zymo Research :
51 - 100 of 6112 citations for Rat Endothelin 2 EDN2 CLIA Kit since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Immunology 2021Quote: ... followed by a final clean-up step by agarose-gel extraction (2% (w/v) gel) with Zymoclean Gel DNA Recovery kit (Zymo Research D4001). Yeast scFv display libraries were generated using the amplified VH and VL DNA libraries from above and the pYD1 yeast surface display vector (Addgene plasmid #73447 ...
-
bioRxiv - Synthetic Biology 2023Quote: ... the clarified cell lysates (2×108 cells) were used to purify total RNA using the Direct-zol RNA MiniPrep kit (Zymo Research, USA). One microgram of total RNA after Turbo DNase I (Thermo Fisher Scientific ...
-
bioRxiv - Cell Biology 2023Quote: ... genomic DNA was isolated from HL-7702 cell lines and 2 μg DNA was treated with sodium bisulfite using an EZ DNA Methylation-Gold Kit (ZYMO Research, USA) according to the manufacturer’s instructions ...
-
bioRxiv - Molecular Biology 2023Quote: ... between 400 million to 1.2 billion cells (two to six flash-frozen pellets) were lysed and extracted using the YeaStar Genomic DNA kit (Zymo 11-323), following the manufacturer’s instructions ...
-
bioRxiv - Cancer Biology 2021Quote: ... genomic DNA and RNA were extracted from fresh frozen tumor (n=2) and normal (n=3) samples using the ZR-Duet DNA/RNA MiniPrep extraction kit (ZYMO RESEARCH, Irvine, CA). Quantification was performed with a NanoDrop One™ spectrophotometer (Thermo Fisher Scientific ...
-
bioRxiv - Synthetic Biology 2023Quote: ... genomic DNA was extracted from 2-10 mL of stationary cultures with the Zymo Research Midiprep gDNA kit (Zymo Research EUROPE GmbH, Germany). Library preparation and sequencing were performed at Novogene (UK ...
-
bioRxiv - Genomics 2023Quote: ... Purification was performed according to manufacturer’s instructions and the converted DNA was then eluted in 32.5 µl nuclease-free water (17 µl × 2 times) through a column from the DNA Clean & Concentrator kit (Zymo Research, cat. no. D4003).
-
bioRxiv - Cancer Biology 2022Quote: ... The outer PCR products amplified using primer #1 and #2 were purified and concentrated using the DNA Clean and Concentrator 5 kit (Zymo Research, Orange, CA) and eluted in 20ul of TE buffer ...
-
bioRxiv - Physiology 2023Quote: ... Complementary DNA (cDNA) was synthesized from 1 to 2 μg of RNA using High-Capacity RNA-to-cDNA™ Kit (Zymo Research, Irvine, CA). Quantitative real-time polymerase chain reaction (qPCR ...
-
bioRxiv - Cell Biology 2024Quote: ... Samples were then treated with Turbo DNAse 2 to 3 times and then purified with the RNA Clean and Concentrator-5 Kit (Zymo Research Cat#: 11-325) according to the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2019Quote: ... 2 U/mL Zymolyase (Zymo research), 22 U/mL lysostaphin (MERCK) ...
-
bioRxiv - Microbiology 2021Quote: ... 2 U/mL Zymolyase (Zymo research), 22 U/mL lysostaphin (MERCK) ...
-
bioRxiv - Pharmacology and Toxicology 2020Quote: RNA was isolated from the cell culture supernatant of SARS-CoV-2-infected cells using the Quick-RNA Viral Kit (Zymo, California, USA cat no. R1035) according to the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2022Quote: ... 2 U/mL Zymolyase (Zymo Research Corporation), 22 U/mL lysostaphin (Sigma-Aldrich) ...
-
bioRxiv - Pharmacology and Toxicology 2023Quote: ... RNA was isolated from rat kidney samples and PTC cultures using Trizol + Direct-zol columns according to the referenced protocol (Zymo Research). For PTC cultures ...
-
bioRxiv - Molecular Biology 2023Quote: ... and 2 volumes of RNA binding buffer (ZYMO) was added to each volume of RNA sample ...
-
bioRxiv - Microbiology 2020Quote: ... Most of the supernatant was removed and 750 μl of ZymoBIOMICS Lysis Solution and 19 μl of proteinase K (D3001-2-20/D3001-2-5, Zymo Research) were added to the remaining 200 μl of the samples and incubated for 30 min at +55 °C ...
-
bioRxiv - Microbiology 2019Quote: ... 2 times volume of Viral RNA Buffer from Zymo Research (R1034-1-100 ...
-
bioRxiv - Genomics 2022Quote: ... 0.25 μL of Proteinase K (Zymo, D3001-2-5), and 2.5μL of H2O ...
-
bioRxiv - Microbiology 2023Quote: ... 2 U/mL Zymolyase (Zymo Research Corporation, CA, USA), 22 U/mL lysostaphin (Sigma-Aldrich) ...
-
bioRxiv - Microbiology 2023Quote: ... pellet resuspended with 2 ml Host Depletion Solution (Zymo) and transferred without the beads to two 1.5 ml tubes per sample ...
-
bioRxiv - Microbiology 2022Quote: ... Gel extraction kit and DNA purification kit were from Zymo Research ...
-
bioRxiv - Neuroscience 2020Quote: ... 1 ml Proteinase K (20 mg, Zymo D3001-2-20), 9 mL water ...
-
bioRxiv - Microbiology 2023Quote: ... 2 mock community samples (Zymo Research DNA standard I D6305), 2 negative DNA extraction samples ...
-
bioRxiv - Microbiology 2023Quote: ... 2 mock community samples (Zymo Research DNA standard I D6305), 2 negative DNA extraction samples ...
-
bioRxiv - Cell Biology 2019Quote: RNA was isolated using a commercial kit (RNAmicro kit, Zymo Research), according to the manufacturer’s instructions ...
-
bioRxiv - Genomics 2023Quote: ... Plasmid is extracted from the bacterial culture using a 96-well mini-prep kit (Zymo kit, Zippy 96 plasmid kit). All clones are sequenced by Sanger sequencing at the site of the barcode using primer ACTTGTGTAGCGCCAAGTGC ...
-
bioRxiv - Synthetic Biology 2022Quote: ... 10 µL of Mag-Binding beads (Zymo Research, #D4100-2-24) was added and the sample was incubated for 3 min at room temperature ...
-
bioRxiv - Genetics 2019Quote: ... and gel extraction kit (Zymoclean Gel DNA Recovery Kit) were from Zymo Research ...
-
bioRxiv - Bioengineering 2022Quote: ... using a commercial kit (ZymoPURE II Plasmid Maxiprep Kit; Zymo Research Corp). HEK293Ta cells (Genecopoeia ...
-
bioRxiv - Biophysics 2021Quote: ... Plasmids used for nucleofections were purified by Zymo midiprep kit (Zymo D4200) and concentrations were quantified by absorption at 260 nm ...
-
bioRxiv - Synthetic Biology 2023Quote: ... coli Transformation Kit (Zymo).
-
bioRxiv - Biophysics 2023Quote: ... Plasmids were purified by Zymo midiprep kit (Zymo D4200) and all cloning was confirmed by Sanger sequencing ...
-
bioRxiv - Microbiology 2023Quote: ... coli Transformation Kit (Zymo).
-
bioRxiv - Molecular Biology 2022Quote: ... ZymoPure Plasmid Midiprep kit and RNA Clean & Concentrator kit were purchased from Zymo Research ...
-
bioRxiv - Microbiology 2023Quote: ... RNA was isolated using a commercial kit (DirectZol RNA Miniprep kit, Zymo Research) following manufacturer instructions ...
-
bioRxiv - Biochemistry 2023Quote: ... ZymoPURE II Midiprep Kit or the ZymoPURE II Maxiprep Kit (all Zymo Research).
-
bioRxiv - Immunology 2023Quote: ... the RNeasy Plus kit (specifically, the Quick RNA miniprep plus kit, Zymo, USA) was utilized and RNA was quantitated with Qubit RNA HS (High Sensitivity ...
-
bioRxiv - Molecular Biology 2023Quote: ... DNA and RNA were extracted using commercial kits: Quick-DNA-fungal/bacterial MiniPrep™ kit (ZymoResearch) was used for DNA and Quick-RNA-fungal/bacterial MiniPrep™ kit (Zymo Research) was used for RNA ...
-
bioRxiv - Synthetic Biology 2022Quote: ... coli using GeneJet plasmid miniprep kit (ThermoScientific) or ZymoPURE plasmid midiprep kit (Zymo Research). Sequences of all plasmids were confirmed using Sanger sequencing performed by Eurofins Genomics ...
-
bioRxiv - Microbiology 2023Quote: ... coli using GeneJet plasmid miniprep kit (ThermoScientific) or ZymoPURE plasmid midiprep kit (Zymo Research). Sequences of all plasmids were confirmed using Sanger sequencing performed by Eurofins Genomics ...
-
bioRxiv - Microbiology 2024Quote: ... The three PCR fragments were purified (Zymo DNA Clean and Concentrator kit: ‘Zymo kit’) and used in a 1:1:1 molar ratio Golden Gate assembly reaction with BsaI (NEB ...
-
bioRxiv - Microbiology 2021Quote: ... coli transformation kit (Zymo Research) or standard electro-transformation protocols ...
-
bioRxiv - Neuroscience 2020Quote: ... or MiniPrep Kit (R2052, Zymo Research ...
-
bioRxiv - Synthetic Biology 2020Quote: ... coli Transformation Kit (Zymo Research).
-
bioRxiv - Synthetic Biology 2021Quote: ... coli Transformation Kit from Zymo Research (Irvine ...
-
bioRxiv - Genomics 2021Quote: ... the RCC kit (Zymo Research).
-
bioRxiv - Developmental Biology 2020Quote: ... or Quick-RNA kit (Zymo). Reverse transcription was carried out by using the High-Capacity RNA-to-cDNA Kit (ThermoFisher) ...
-
bioRxiv - Synthetic Biology 2023Quote: ... coli Transformation Kit (Zymo Research). For each transformation ...
-
bioRxiv - Developmental Biology 2023Quote: ... and RNA purification kit (Zymo). cDNA was generated using Maxima First Strand cDNA synthesis kit (Thermo Fisher Scientific) ...