Labshake search
Citations for Zymo Research :
851 - 900 of 9639 citations since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Immunology 2024Quote: ... RNA from perfused hemolymph samples was isolated using the Direct-Zol RNA miniprep kit (Zymo Research). Two micrograms of non-hemolymph-derived or 200ng of hemolymph-derived total RNA were used for first-strand synthesis with the RevertAid reverse transcriptase kit (Thermo Fisher Scientific) ...
-
bioRxiv - Immunology 2024Quote: ... coli were resuspended in 1 ml of TRIzol and their RNA was purified using Quick-RNA DirectZol columns ((#ZR2072 Zymo Research Ozyme) according to the manufacturer’s instructions ...
-
bioRxiv - Immunology 2024Quote: ... PCR products were purified using the DNA Clean & Concentrator kit (Zymo Research) following gel electrophoresis to test for target specificity ...
-
bioRxiv - Immunology 2024Quote: Total RNA was extracted from 1*106 WT or sorted SLAMF6-KO NK-92 cells using an RNA Micro Kit (Zymo Research). After PolyA selection libraries were prepared and lllumina sequencing of 20-30 million paired-end reads performed ...
-
bioRxiv - Immunology 2024Quote: ... The RNA from the alkylation reaction was then purified using RNA Clean & Concentrator (Zymo, #R1015), and 0.5 μg RNA was used as input for strand-specific library Prep Kit (Vazyme ...
-
bioRxiv - Microbiology 2024Quote: ... and the pellet was resuspended in 1000 µl of fresh TRIzol (Zymo research). The cells were lysed by bead beating for 45 and 30 seconds with 5 minutes gap between ...
-
bioRxiv - Microbiology 2024Quote: ... we used kits from Zymo Research ...
-
bioRxiv - Microbiology 2024Quote: ... Genomic DNA was extracted from the pools using the Quick-DNA Fungal/Bacterial Miniprep Kit from Zymo Research (Cat ...
-
bioRxiv - Microbiology 2024Quote: DNA was extracted from pelleted cells as described previously16 using a ZymoBiomics DNA Miniprep kit (Zymo Research; Irvine, CA, USA) according to the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2024Quote: ... PCR products were pooled and purified with a DNA Clean & Concentrator purification kit (Zymo Research, San Diego, CA, USA). The pooled amplicon library was sequenced on an Illumina MiSeq platform at the Idaho State University Molecular Research Core Facility (RRID:SCR_012598).
-
bioRxiv - Microbiology 2024Quote: ... Cell pellets were resuspended in DNA stabilization buffer (Zymo Research, San Diego, CA, USA) for DNA extraction.
-
bioRxiv - Immunology 2024Quote: ... and Direct-zol RNA microprep Kit (#ZR2070T Zymo Research Ozyme) following the manufacturer’s instructions ...
-
bioRxiv - Immunology 2024Quote: ... Cells were then lysed using the Direct-zol™ RNA Mini Prep kit (Zymo Research). cDNA was synthesized from the isolated RNA using the ProtoScript® First Strand cDNA Synthesis Kit (Bio-Labs) ...
-
bioRxiv - Molecular Biology 2024Quote: ... RNA was treated with a RNA Clean and Concentrator kit (Zymo) followed by DNAse treatment (TURBO DNA-free kit ...
-
bioRxiv - Molecular Biology 2024Quote: ... and purified using a DNA clean and concentrator kit (Zymo research, USA). SYBR green assay was used for cccDNA detection with a calibration curve as described above to calculate HBV Geq ...
-
bioRxiv - Molecular Biology 2024Quote: ... cells were collected and RNA was extracted using Direct-zol RNA mini-prep kit (Zymo research) following manufacturer instructions 24/48 hours after transfection of overexpression constructs ...
-
bioRxiv - Molecular Biology 2024Quote: ... The total RNA was extracted with Direct-zol RNA Purification Kits (Zymo Research, Cat. No. R2050). 7 µg of total RNA was subjected to immunoprecipitation with an m6A antibody (P9016 ...
-
bioRxiv - Molecular Biology 2024Quote: ... Ten percent of the clarified lysate by volume was reserved for RNA extraction using Direct-zol RNA Purification Kits (Zymo Research, Cat. No. R2050). The RNA-seq libraries were prepared using the NEBNext Ultra™ II RNA Library Prep Kit for Illumina following manufecturer’s protocol by Novagene.
-
bioRxiv - Molecular Biology 2024Quote: ... and RNA was extracted according to the manufacturer’s instructions (Zymo Direct-zol RNA Kits, Cat. No. R2061). 5 μg of total RNA without poly(A ...
-
bioRxiv - Microbiology 2024Quote: ... Total RNA was collected over a time course of 24 hours and isolated using a Quick-DNA/RNA™ Miniprep kit (Zymo) according to the manufacturer’s protocol ...
-
bioRxiv - Microbiology 2024Quote: ... RNA was isolated with a Quick-DNA/RNA™ Miniprep kit (Zymo, Irvine, CA) then treated with 5U/sample DNAseI (Zymo ...
-
bioRxiv - Microbiology 2024Quote: Total RNA was extracted using a Quick-DNA/RNA™ Miniprep kit (Zymo), then treated with 5U/sample DNAseI (Zymo ...
-
bioRxiv - Microbiology 2024Quote: ... and processed with an RNA Clean & Concentrate kit (Zymo). The next-generation sequencing (NGS ...
-
bioRxiv - Microbiology 2024Quote: ... and processed with an RNA Clean & Concentrate kit (Zymo) according to the manufacturer’s protocol ...
-
bioRxiv - Microbiology 2024Quote: ... total DNA was isolated using a Quick-DNA/RNA™ Miniprep kit (Zymo) according to the manufacturer’s protocol ...
-
bioRxiv - Microbiology 2024Quote: ... after which their genomic DNA was extracted using the Quick-DNA Midiprep Plus Kit (ZYMO Research, #D4075). DNA fragments containing the sgRNA sequences were amplified by PCR using primers lentiGuidePCR1-F (AATGGACTATCATATGCTTACCGTAACTTGAAAGTATTTCG ...
-
bioRxiv - Microbiology 2024Quote: ... and the RNA Clean and Concentrator kit (Zymo Research). The RNA was DNase-treated using the TURBO DNA-freeTM kit (Invitrogen ...
-
bioRxiv - Microbiology 2024Quote: ... Fungal cell walls were digested by adding 5 units of Zymolyase (Zymo Research, CA, USA) and further incubation for 60 min at 37 °C ...
-
bioRxiv - Microbiology 2024Quote: RNA was extracted from oyster powder (individual) by using the Direct-Zol RNA miniprep kit (Zymo Research) according to the manufacturer’s protocol ...
-
bioRxiv - Microbiology 2024Quote: ... following manufacturer instructions or gel-purified from kit (Zymo Research). Plasmids were assembled using NEBuilder HiFi DNA assembly kit (NEB) ...
-
bioRxiv - Microbiology 2024Quote: ... The blocked DNA was purified using a DNA cleanup kit (Zymo Catalog # 11-304C).
-
bioRxiv - Microbiology 2024Quote: ... Excess unincorporated ddGTPs were removed by a DNA Clean & Concentrator kit (Zymo #11- 304C). DNA was then digested as previously published (15 ...
-
bioRxiv - Microbiology 2024Quote: ... The capped DNA was washed using a DNA Clean & Concentrator kit (Zymo #11-304C).
-
bioRxiv - Microbiology 2024Quote: ... The pooled library was cleaned with Select-a-Size DNA Clean & ConcentratorTM (Zymo Research, Irvine, CA, United States), then quantified with TapeStation (Agilent ...
-
bioRxiv - Microbiology 2024Quote: ... then treated with 5U/sample DNAseI (Zymo) and processed with an RNA Clean & Concentrate kit (Zymo ...
-
bioRxiv - Microbiology 2024Quote: ... then treated with 5U/sample DNAseI (Zymo) and processed with an RNA Clean & Concentrate kit (Zymo) ...
-
bioRxiv - Molecular Biology 2024Quote: ... and DNA was extracted using Quick-DNA Miniprep Plus kit (Zymo Research). m6A levels at GATC were measured by Dpn II digestion followed by quantitative PCR.
-
bioRxiv - Microbiology 2024Quote: ... and RNA was extracted following the manufacturers instructions (Zymo Quick-RNATM Viral Kit or QIAGEN RNeasy Mini Kit ...
-
bioRxiv - Microbiology 2024Quote: ... throat swabs and turbinate homogenates were processed immediately in viral RNA buffer (Zymo Research) and RLT lysis buffer (QIAGEN ...
-
bioRxiv - Microbiology 2024Quote: ... Bacteria expressing the correct plasmid were grown in bulk and high-purity plasmid was extracted using ZymoPURE Plasmid Midiprep kit (Zymo research) and verified by sequencing of the coding region of the influenza virus segment.
-
bioRxiv - Microbiology 2024Quote: ... excess unincorporated ddNTPs were removed by treatment with a DNA Clean & Concentrator kit (Zymo #11-304C). Finally ...
-
Polyunsaturated Fatty Acid - mediated Cellular Rejuvenation for Reversing Age-related Vision DeclinebioRxiv - Molecular Biology 2024Quote: ... Methylated DNA was converted using EZ DNA Methylation-Direct™ Kit (Zymo Research, USA) following the instructions of the manufacturer ...
-
bioRxiv - Molecular Biology 2024Quote: ... The cells were lysed in TRIzol reagent (Zymo Research, Cat. No. R2050) and RNA was extracted according to the manufacturer’s instructions (Zymo Direct-zol RNA Kits ...
-
bioRxiv - Neuroscience 2024Quote: ... per manufacturer recommendations followed by Zymo Direct-zol column purification kit (Zymo Research ...
-
bioRxiv - Neuroscience 2024Quote: ... per manufacturer recommendations followed by Zymo Direct-zol column purification kit (Zymo Research, Cat # R2062). Library preparation was performed in 2 equal batches by Salk’s Next Generation Sequencing Core ...
-
bioRxiv - Molecular Biology 2024Quote: ... and repurified using a DNA Clean and Concentrator-5 Kit (Zymo #D4004). Next ...
-
bioRxiv - Molecular Biology 2024Quote: ... DNA was immediately purified using column purification (Zymo #D4004) and eluted in 10 ml nuclease-free water ...
-
bioRxiv - Molecular Biology 2024Quote: ... and library DNA was extracted by ZymoPURE II Plasmid Midiprep kit (Zymo research). For CFU measurement and control sample preparation for next-generation sequence analysis ...
-
bioRxiv - Molecular Biology 2024Quote: ... and day 28 samples using Zymoprep Yeast Plasmid kit (Zymo Research, D2004), with the following changes ...
-
bioRxiv - Molecular Biology 2024Quote: ... The samples were then reverse-crosslinked overnight in elution buffer (1 % SDS, 0.1 M NaHCO3) and purified using the ChIP DNA Clean & Concentrator kit (Zymo Research) following manufacturer instructions ...