Labshake search
Citations for Zymo Research :
801 - 850 of 3598 citations for DNA Mismatch Repair Protein Msh3 MSH3 Antibody since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2023Quote: Genomic DNA was extracted from the frozen cell pellets using ZymoBIOMICS DNA Miniprep Kits (Zymo Research, #D4300) following the manufacturer’s instructions with the following modifications ...
-
bioRxiv - Neuroscience 2023Quote: Genome-wide DNA methylation levels were determined using the 5-mC DNA ELISA Kit (Zymo Research, D5325) per the manufacturer’s instruction ...
-
bioRxiv - Microbiology 2023Quote: ... genomic DNA was extracted with the Quick-DNA™ Fungal/Bacterial Miniprep kit (Zymo Research, Irvine, CA) and purified with the Genomic DNA Clean & Concentrator™ kit (Zymo Research) ...
-
bioRxiv - Genomics 2023Quote: ... Genomic DNA (100ng) was bisulfite-converted with the EZ-DNA Methylation-Gold kit (Zymo, Irvine, CA, USA) prior to preparation of the library with the Accel-NGS Methyl-Seq DNA Library Kit (Swift Biosciences ...
-
bioRxiv - Genomics 2023Quote: ... followed by reverse crosslinking (as above) and DNA purification with ChIP DNA Clean and Concentrator kit (Zymo). Sequencing libraries were prepared from 1-5ng ChIP DNA using the NEBNext Ultra II DNA Library Prep kit with NEBNext Single indices (E7645 ...
-
bioRxiv - Systems Biology 2023Quote: ... The crude DNA extracts were purified by a Zymo DNA Clean & Concentrator™-5 kit (Zymo Research) prior to PCR amplification and then NGS sequencing was performed.
-
bioRxiv - Genetics 2024Quote: ... 200 ng of DNA were bisulfite converted using the EZ DNA Methylation kit (Zymo Research, Irvine, CA) according to the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2022Quote: ... DNA from pond water samples was cleaned using the Genomic DNA Clean & Concentrator kit (D4010, Zymo Research), quantified with the Qubit dsDNA BR Kit (Q32850 ...
-
bioRxiv - Cancer Biology 2022Quote: ... cells were harvested for genomic DNA extraction using a Quick-DNA Miniprep kit (Zymo Research, Cat. #D3025) following the manufacturer’s instructions ...
-
bioRxiv - Cancer Biology 2022Quote: EZ DNA Methylation-Lightning Kit was used to bisulfite-convert DNA samples (Zymo Research, Irvine, CA, USA). SeqCap Epi CpGiant Enrichment Kit (Hoffmann-La Roche ...
-
bioRxiv - Microbiology 2022Quote: ... High molecular weight DNA was obtained using the ZymoBIOMICS DNA Miniprep Kit (Zymo Research, Irvine, Ca, USA) in accordance with manufacturer’s instructions ...
-
bioRxiv - Molecular Biology 2023Quote: ... and DNA purification was done using the ChIP DNA Clean & Concentrator™ (Zymo Research, Irvine, CA, USA). For RT-qPCR a 20-fold dilution of each immunoprecipitated sample and a 200-fold dilution of input samples were used ...
-
bioRxiv - Genomics 2022Quote: Extracted genomic DNA was treated with the EZ DNA Methylation Kit (catalog #: D5001; Zymo Research, California, USA). Bisulfite-converted DNA was applied to the Infinium MethylationEPIC BeadChip (catalog # ...
-
bioRxiv - Plant Biology 2023Quote: ... 5000 FANSed nuclei were used to extract DNA with the Quick-DNA microprep kit (Zymo Research #D3020).
-
bioRxiv - Genetics 2023Quote: 500 ng of genomic DNA was bisulfite converted with the EZ DNA Methylation-Gold kit (Zymo Research). Bisulfite PCR was performed using EpiTaq (Takara ...
-
bioRxiv - Cancer Biology 2022Quote: Genomic DNA was isolated from each cell line using the Zymo Quick-DNA Miniprep Kit (Zymo D3024) and quantified by Qubit ...
-
bioRxiv - Developmental Biology 2023Quote: ... DNA was bisulfite-converted using the Zymo EZ DNA Methylation™ Kit (Zymo Research, Irvine, CA, USA). Illumina’s Infinium® HumanMethylation450 BeadChip (450K ...
-
bioRxiv - Cancer Biology 2023Quote: ... 100-500 ng DNA was used for bisulfite conversation using the EZ DNA Methylation Kit (Zymo Research). Then the DNA Clean & Concentrator-5 (Zymo Research ...
-
bioRxiv - Genomics 2023Quote: ... The neutralized DNA sample was further purified using Zymo oligo DNA clean and concentrator kit (Zymo Research). The Zymo-cleaned DNA was subjected to anneal by incubating at 90°C for 2 minutes following gradually cooling down to 20°C ...
-
bioRxiv - Cancer Biology 2023Quote: Genomic DNA of sorted GC B cells were isolated by Quick-DNA Microprep Kit (Zymo Research; D3020) according to the manufacturer’s protocol ...
-
bioRxiv - Genetics 2023Quote: ... DNA was treated with sodium bisulfite using EZ-96 DNA Methylation Gold Kit (Zymo Research, Orange, USA), through which non-methylated cytosine (C ...
-
In vitro impact of fluconazole on oral microbial communities, bacterial growth and biofilm formationbioRxiv - Microbiology 2023Quote: ... total DNA was extracted using the Zymo Quick-DNA Fungal/Bacterial Micro prep extraction kit (Zymo Research) and quantified by real-time PCR using Zymo DNA quantification kits for bacteria/fungi (Femto Bacterial and fungal DNA Quantification kit ...
-
bioRxiv - Synthetic Biology 2024Quote: ... and yeast plasmid DNA was extracted via plasmid DNA miniprep using Yeast Miniprep kit II (Zymo Research) then sequenced via whole plasmid Oxford nanopore sequencing to determine the successful expression cassette combinations.
-
bioRxiv - Developmental Biology 2024Quote: ... 500ng of genomic DNA was used for bisulfite conversion with the EZ DNA Methylation Kit (Zymo Research), following the manufacturer’s protocol ...
-
bioRxiv - Genomics 2024Quote: ... 25 ng of genomic DNA was bisulfite converted with the EZ DNA Methylation-Lightning Kit (Zymo Research) per the manufacturer’s protocol ...
-
bioRxiv - Systems Biology 2024Quote: ... The crude DNA extracts were purified by a Zymo DNA Clean & Concentrator™-5 kit (Zymo Research) prior to PCR amplification and NGS sequencing.
-
bioRxiv - Microbiology 2024Quote: ... DNA was extracted from pelleted cells using a ZymoBiomics 96 DNA kit (Zymo Research, Irvine, CA USA) and subjected to 16S rRNA sequencing ...
-
bioRxiv - Microbiology 2024Quote: ... samples were harvested and subjected to total DNA isolation using the ZymoBIOMICS DNA miniprep kit (Zymo Research) following the manufacturer’s instructions and subjected to real-time PCR assay performed with PowerTrack SYBR Green Master Mix (Applied Biosystems™ ...
-
bioRxiv - Synthetic Biology 2024Quote: ... Genomic DNA was extracted from cell lysate using the Genomic DNA Clean & Concentrator-25 kit (Zymo Research) according to the manufacturer’s instructions ...
-
bioRxiv - Immunology 2024Quote: ... DNA fragments were purified from enzyme solution using Zymo DNA Clean and Concentrator TM -5 kit (Zymo). Libraries were barcoded (Nextera Index Kit ...
-
bioRxiv - Neuroscience 2024Quote: ... and sheared DNA was bisulfite converted using the EZ DNA Methylation-Gold kit (Zymo Research, Cat. #D5005) with an elution volume of 15 µL ...
-
bioRxiv - Neuroscience 2024Quote: ... The DNA fragments and libraries were purified using a DNA cleaner and concentrator (ZYMO Research, Irvine, CA). For input ...
-
bioRxiv - Systems Biology 2024Quote: ... The crude DNA extracts were purified by a Zymo DNA Clean & Concentrator™-5 kit (Zymo Research) prior to PCR amplification and NGS sequencing.
-
bioRxiv - Microbiology 2024Quote: ... Genomic DNA was extracted from the pools using the Quick-DNA Fungal/Bacterial Miniprep Kit from Zymo Research (Cat ...
-
bioRxiv - Microbiology 2024Quote: ... after which their genomic DNA was extracted using the Quick-DNA Midiprep Plus Kit (ZYMO Research, #D4075). DNA fragments containing the sgRNA sequences were amplified by PCR using primers lentiGuidePCR1-F (AATGGACTATCATATGCTTACCGTAACTTGAAAGTATTTCG ...
-
bioRxiv - Microbiology 2024Quote: ... DNA was extracted from surface sterilized samples with the ZymoBIOMICS DNA Mini kit (Zymo Research, Irvine, CA) following the manufacturer’s protocol with samples bead beaten on the homogenize setting for 1 min using a BioSpec Products mini-bead beater ...
-
bioRxiv - Plant Biology 2024Quote: ... The DNA was subjected to RNase treatment and then purified using DNA Clean & Concentrator kits (ZYMO, D4004).
-
bioRxiv - Microbiology 2024Quote: ... the DNA was extracted using a genomic DNA Clean and Concentrator kit (Zymo Corp., Irvine, CA, USA).
-
bioRxiv - Genomics 2024Quote: ... DNA fragments were treated twice with bisulfite using an EZ DNA Methylation-GoldTM Kit (Zymo Research, USA) before the resulting single-stranded DNA fragments were PCR amplified via KAPA HiFi HotStart Uracil + ReadyMix (2X) ...
-
bioRxiv - Biochemistry 2024Quote: ... The linearized DNA was purified using the ChIP DNA Clean & Concentrator kit (ZYMO research, Cat No. D5205), and eluted in 10 μl elution buffer ...
-
bioRxiv - Cancer Biology 2024Quote: ... all barcoded animals were fin clipped and DNA from fin samples was extracted (Zymo Quick DNA miniprep). The GESTALT cassette was amplified by PCR using Phusion High-Fidelity PCR Master Mix with HF Buffer (NEB ...
-
bioRxiv - Genetics 2024Quote: ... 750 ng of purified genomic DNA was bisulfite converted using the EZ DNA Methylation Kit (Zymo Research) as per the manufacturer’s instructions ...
-
bioRxiv - Evolutionary Biology 2024Quote: ... DNA was extracted from each culture using the Quick-DNA Fecal/Soil Microbe Miniprep Kit from Zymo Research (Irvine ...
-
bioRxiv - Developmental Biology 2021Quote: ... a mouse 110 kb BAC clone encoding Nctc1 and Igf2 was purchased from Thermo Fisher Scientific (RPCI23.C) and the DNA was prepared with a ZR BAC DNA Miniprep kit (Zymo Research (D4048)) as control ...
-
bioRxiv - Developmental Biology 2021Quote: ... The resulting DNA was purified using columns and reagents from the EZ DNA Methylation Direct kit (Zymo Research). First-strand synthesis was performed with Klenow Exo-enzyme (New England Biolabs ...
-
bioRxiv - Cell Biology 2020Quote: ... and 250ng of DNA was bisulfite converted per sample using the EZ DNA Methylation-Gold kit (Zymo Research) according to the manufactuer’s protocol ...
-
bioRxiv - Genetics 2021Quote: ... The microbial DNA was extracted using the Quick-DNA Fecal Microbe Miniprep Kit™ (Zymo Research, Freiburg, Germany) and a 15 min bead-beating step at 30 Hz was applied ...
-
bioRxiv - Microbiology 2021Quote: ... The obtained genomic DNA was purified using the Soil Microbe DNA kit MiniPrep ZR™ (Zymo Research, USA) according to the manufacturer’s instructions ...
-
bioRxiv - Molecular Biology 2020Quote: Genomic DNA (gDNA) was extracted using ZR-Duet™DNA/RNA MiniPrep (D7005; Zymo Research, Irvine, CA, USA) according to manufacturing instructions (n=4/mCHD ...
-
bioRxiv - Molecular Biology 2021Quote: ... Bisulfite conversion was performed on 500μg of DNA using Zymo EZ-96 DNA methylation Kit (Zymo Research, USA). DNA methylation profiling was performed using the Illumina Infinium HumanMethylation 450K array (Illumina ...