Labshake search
Citations for Zymo Research :
7351 - 7400 of 9639 citations since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Genomics 2021Quote: ... the DNA was bisulfite-converted (Zymo EZ DNA methylation Kit; Zymo Research) and profiled using an Illumina Human EPIC array (EPIC) ...
-
bioRxiv - Microbiology 2021Quote: ... and 50 uL of the pooled PCR product was purified with the DNA Clean and Concentrator kit (Zymo Research). The final BarSeq library was eluted in 40 uL water ...
-
bioRxiv - Microbiology 2021Quote: ... 50 µl of apical wash was used for the extraction of nuclease digestion-resistant viral RNA using the Quick-RNA Viral kit (#R1035; Zymo Research, Irvine, CA), as described previously (36) ...
-
bioRxiv - Microbiology 2021Quote: ... Whole metagenome DNA was extracted using a ZymoBIOMICS DNA kit (Zymo) following the manufacturer recommended protocol ...
-
bioRxiv - Microbiology 2021Quote: ... 0.1 g of human stool was homogenized in 8 mL salt magnesium plus (SM+) buffer [99] and 0.5 ml of homogenate was transferred to a BashingBead Lysis tube (Zymo) and designated as the whole metagenome sample ...
-
bioRxiv - Microbiology 2021Quote: 16S rRNA gene analysis was performed using fecal samples that were processed for isolation of whole metagenomic DNA using a ZymoBIOMICS DNA kit (Zymo) and stored at -80°C ...
-
bioRxiv - Immunology 2021Quote: ... RNA isolation was done with the Direct-zol RNA Miniprep (Zymo Research, catalog no. R2052) according to the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2021Quote: ... Each strain was grown in 1 ml of LB+CA100 at 30°C for 48 hours and genomic DNA was extracted using a Quick-DNA High Molecular Weight kit (Zymo Research, cat#D6060) according to the manufacturer’s protocol ...
-
bioRxiv - Microbiology 2021Quote: ... RNA was extracted from filters using the Direct-zol RNA MicroPrep (Zymo Research, USA) after they had been previously thawed ...
-
bioRxiv - Microbiology 2021Quote: ... PES filters (5 μm and 0.22 μm pore sizes) were loaded into cryo-vials pre-filled with 500 μl of DNA/RNA Shield (Zymo Research, USA) and stored at −80°C ...
-
bioRxiv - Immunology 2021Quote: ... and DNAse treated per the manufacturer’s instructions (Zymo Research). Superscript III (Invitrogen ...
-
bioRxiv - Neuroscience 2021Quote: ... cultured neurons at 15 DIV were left untreated or treated for 48 h with 2 μM TTX and then processed for total RNA extraction using the kit Direct-zol™ RNA MicroPrep (Zymo Research) according to the manufacturer’s instructions ...
-
bioRxiv - Neuroscience 2021Quote: The ZymoBIOMICS® Microbial Community Standard (Zymo Research) was used as a positive control for each DNA extraction ...
-
bioRxiv - Neuroscience 2021Quote: ... The ZymoBIOMICS® Microbial Community DNA Standard (Zymo Research) was used as a positive control for each targeted library preparation ...
-
bioRxiv - Neuroscience 2021Quote: ... Total RNA was isolated using Quick-RNA Miniprep Kit (ZYMO research, R1054) according to the manufacturer’s instructions and 10μL of RNA was used for real-time quantitative PCR using qScript One-Step SYBR Green qRT-PCR kit (QuantaBio ...
-
bioRxiv - Pharmacology and Toxicology 2021Quote: ... Following desalting using an Oligo Clean & Concentrator (Zymo Research), the samples were subjected to MALDI-TOF MS (Bruker ultrafleXtreme ...
-
bioRxiv - Pharmacology and Toxicology 2021Quote: ... Desalting of the reaction mixture was performed with an Oligo Clean & Concentrator kit (Zymo Research) resulting in ∼10 µL purified aqueous RNA solutions ...
-
bioRxiv - Pharmacology and Toxicology 2021Quote: ... Desalting of the reaction mixture was performed with an Oligo Clean & Concentrator kit (Zymo Research) resulting in ∼10 µL purified aqueous RNA solutions ...
-
bioRxiv - Pharmacology and Toxicology 2021Quote: ... Following desalting using an Oligo Clean & Concentrator (Zymo Research), the samples were subjected to MALDI-TOF MS (Bruker ultrafleXtreme ...
-
bioRxiv - Pharmacology and Toxicology 2021Quote: ... Desalting of the reaction mixture was performed with an Oligo Clean & Concentrator kit (Zymo Research) resulting in ∼10 µL purified aqueous RNA solutions ...
-
bioRxiv - Pharmacology and Toxicology 2021Quote: ... Desalting of the reaction mixture was performed with an Oligo Clean & Concentrator kit (Zymo Research) resulting in ∼10 µL purified aqueous RNA solutions ...
-
bioRxiv - Evolutionary Biology 2021Quote: ... using Direct-zol™ RNA MiniPrep Plus kits (Zymo, R2072) with an additional Chloroform step before loading the sample onto filtration columns ...
-
bioRxiv - Evolutionary Biology 2021Quote: ... The sample was then centrifuged at 2300 rpm for 5 min and the supernatant was collected and concentrated and purified using a Zymo-Spin V reservoir (Zymo Research Irvine, CA, USA) and Qiagen MinElute spin column (Qiagen ...
-
bioRxiv - Immunology 2021Quote: ... RNA was isolated from TRI Reagent samples using phenol-chloroform extraction or column-based extraction systems (Direct-zol RNA Miniprep, Zymo Research) according to the manufacturer’s protocol ...
-
bioRxiv - Immunology 2021Quote: ... LNs were transferred to a beadbeater and homogenized in TRI Reagent (Zymo Research). Samples were then centrifuged ...
-
bioRxiv - Microbiology 2021Quote: RNA was isolated using the Direct-zol RNA Miniprep Plus Kit (Zymo) according to the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2021Quote: ... the cells and cellular supernatant in a volume of 100μl were lysed and inactivated by addition of 300μl TRI reagent (Zymo). RT-qPCR on viral genomes was performed using the N1 CDC primer set from IDT (2019-nCoV_N1-F GACCCCAAAATCAGCGAAAT and 2019-nCoV_N1-R TCTGGTTACTGCCAGTTGAATCTG ...
-
bioRxiv - Pharmacology and Toxicology 2021Quote: ... Desalting of the reaction mixture was performed with an Oligo Clean & Concentrator kit (Zymo Research) resulting in ∼10 µL purified aqueous RNA solutions ...
-
bioRxiv - Pharmacology and Toxicology 2021Quote: ... Desalting of the reaction mixture was performed with an Oligo Clean & Concentrator kit (Zymo Research) resulting in ∼10 µL purified aqueous RNA solutions ...
-
bioRxiv - Microbiology 2021Quote: Double-stranded DNA was then purified from the lysates using a Zymo Genomic DNA Clean & Concentrator Kit-10 (Zymo Research, Irvine, CA, USA) according to the manufacturer’s protocols ...
-
bioRxiv - Microbiology 2021Quote: ... DNA with a size of at least ~200 bases was excised and purified using a gel DNA recovery kit (Zymo Research) with elution in 50 μl of nuclease-free water ...
-
bioRxiv - Developmental Biology 2021Quote: ... RNA was extracted by Zymo Research Direct-zol™ RNA MiniPrep kit (Catalog #R2050) ...
-
bioRxiv - Plant Biology 2021Quote: ... DNA was then purified using DNA Clean and Concentrator-25 columns (Zymo Research) and eluted in 100 µL of elution buffer.
-
bioRxiv - Plant Biology 2021Quote: Total RNA was extracted from the whole rosette leaves of 32 day-old control and drought-stressed plants using the Quick-RNA Miniprep Kit (Zymo-Research, USA). RNA quality and quantity were determined using a Nabi UV/Vis Nano Spectrophotometer (LTF Labortechnik ...
-
bioRxiv - Neuroscience 2021Quote: ... After concentrating the product with a DNA Clean & Concentrator Kit (Zymo Research), the cDNA was purified with 0.6X AMpure XP beads (Beckman) ...
-
bioRxiv - Neuroscience 2021Quote: ... and total RNA was isolated and purified with Direct-zol™ MiniPrep Plus (Zymo Research, Irvine, CA, USA) according to the manufacturer’s protocol ...
-
bioRxiv - Neuroscience 2021Quote: ... followed by purification with Zymoclean™ Gel DNA Recovery Kit (Zymo, D4007). Library concentration was determined with an Agilent 2100 Bioanalyzer after which 8 samples were pooled and sequenced using HiSeq Rapid SBS Kit v2 (50 cycles ...
-
bioRxiv - Neuroscience 2021Quote: ... The transposed DNA fragments were further amplified and barcoded (Buenrostro et al., 2013, 2015) and purified with a ChIP DNA Clean & Concentrator kit (Zymo, D5205). The fragments were run on 2% E-Gel™ EX agarose gels (Thermo Fisher scientific ...
-
bioRxiv - Neuroscience 2021Quote: RNA was extracted from hSS and hCS using the Quick-RNA Miniprep kit (Zymo Research, R1054). For library construction ...
-
bioRxiv - Neuroscience 2021Quote: ... RNA was treated with DNase I (ZYMO: cat# R2051). The yield of RNA was determined with a Denovix DS-11 Series Spectrophotometer (Denovix) ...
-
bioRxiv - Neuroscience 2021Quote: RNA isolation was performed with the Direct-Zol RNA miniprep kit (ZYMO: cat# R2051) according to the manufacturer’s instructions ...
-
bioRxiv - Plant Biology 2021Quote: ... Total genomic DNA from mycelial balls was isolated using a Quick-DNA™ Fungal/ Bacterial Miniprep Kit (Zymo Research, USA) as per the manufacturer’s instructions.
-
bioRxiv - Cell Biology 2021Quote: Cellular small RNAs and extracellular RNAs were successively treated with DNase I (Zymo Research, Cat# R1014), T4 Polynucleotide Kinase (New England Biolab ...
-
bioRxiv - Cell Biology 2021Quote: ... the RNA was cleaned to remove enzyme and buffer components using the RNA Clean & Concentrator-5 kit (Zymo Research, Cat# R1014) before the next treatment ...
-
bioRxiv - Microbiology 2021Quote: ... RNA was isolated and purified from cells using a ZR-Duet DNA/RNA MiniPrep kit (Zymo Research). Next ...
-
bioRxiv - Cell Biology 2021Quote: ... DNA was isolated and purified with a ZYMO DNA clean & Concentrator (ZYMO RESEARCH, #D4013).
-
bioRxiv - Cell Biology 2021Quote: Cellular and tissue total RNA was extracted using TRI reagent and Direct-zol RNA MiniPrep Plus kit (Zymo Research, Irvine, CA). First-strand cDNA was synthesized using the SuperScriptTM IV VILOTM cDNA synthesis kit (Thermo Fisher Scientific) ...
-
bioRxiv - Microbiology 2021Quote: ... DNase was then removed using an RNA Clean-Up kit (Zymo Research). First-strand cDNA synthesis was performed using the Retroscript first-strand synthesis kit (Ambion) ...
-
bioRxiv - Physiology 2021Quote: DNA was extracted from at least 250 mg of raw colostrum using the Quick DNA Fecal/Soil Microbe kit (Zymo Research, Irvine, CA, USA). DNA yield and quality were determined after Nanodrop 1000 and Qubit spectrophotometric quantifications ...
-
bioRxiv - Biochemistry 2021Quote: ... total RNA was collected from cells using an RNA isolation kit (Zymo, Santa Cruz, CA). Total RNA underwent reverse transcription (RT ...