Labshake search
Citations for Zymo Research :
451 - 500 of 1390 citations for 3 Hydrazino 5 methyl 4H 1 2 4 triazol 4 ylamine hydrochloride since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Developmental Biology 2022Quote: Linearized plasmid DNA was cleaned using DNA Clean & concentrator-5 (Zymo Research #D4014). In situ hybridization was completed according to a standard protocol (Cunningham and Monk ...
-
bioRxiv - Molecular Biology 2022Quote: ... The product was cleaned up using RNA Clean & Concentrator-5 kit (ZYMO, R1013) and added into 20 μl of reverse transcription and strand-switching reaction containing 100 nM custom primer (5’ - phos/ ACTTGCCTGTCGCTCTATCTTCATTGATGGTGCCTACAG - 3’) ...
-
bioRxiv - Molecular Biology 2022Quote: ... rRNA-depleted RNA was purified by RNA Clean & Concentrator-5 kit (ZYMO, R1013) and then ligated to 50 pmol 3’ adapter (5’-rAppCTGTAGGCACCATCAAT - NH2-3’ ...
-
bioRxiv - Microbiology 2022Quote: ... The DMS-modified RNA was purified using RNA Clean and ConcentratorTM-5 (Zymo) and eluted in 10µl water.
-
bioRxiv - Genetics 2022Quote: ... followed by another round of clean up (Zymo RNA Clean and Concentrator 5). The final sequence of the spike-in mRNA is ...
-
bioRxiv - Bioengineering 2022Quote: ... DNA products were purified using the DNA Clean & Concentrator-5 Kit (Zymo Research). All purified PCR products were visually checked for expected size via 1% agarose gel electrophoresis and assessed for purity and yield via Nanodrop (Thermo Fisher Scientific).
-
bioRxiv - Microbiology 2020Quote: ... and subsequently purified using the RNA Clean and Concentrate −5 kit (Zymo Research). RNA was then prepped for deep-sequencing using the TruSeq Stranded mRNA Library Preparation Kit (Illumina ...
-
bioRxiv - Plant Biology 2021Quote: ... The remaining RNA was recovered with RNA Clean & Concentrator-5 (Zymo Research, USA). RNA fragments ranging from 200–1000 nucleotides in size were validated on an Agilent 2100 Bioanalyzer.
-
bioRxiv - Molecular Biology 2022Quote: ... Eluted RNA was purified with Zymo RNA Clean & Concentrator-5 columns (Zymo Research), reverse-transcribed with SuperScript IV (ThermoFisher Scientific) ...
-
bioRxiv - Microbiology 2022Quote: ... the RNA was purified using the RNA Clean & Concentrator-5 kit (Zymo Research). The 3’ barcoded adaptors were ligated onto the RNA by mixing 5 µl of the dephosphorylated RNA with 100 µM of the barcoded adaptor and heating for 2 min at 70°C before transfer to ice ...
-
bioRxiv - Biochemistry 2022Quote: ... followed by column purification using RNA Clean & Concentrator Kit-5 (R1015, Zymo Research). End-repaired RPFs RNA were eluted in 20 µL of nuclease-free water ...
-
bioRxiv - Biochemistry 2022Quote: ... RNAs were further purified through RNA Clean and Concentrator-5 (R1013, Zymo Research) and eluted in 8 μL ...
-
bioRxiv - Microbiology 2022Quote: ... After reaction clean-up using ZYMO RNA Clean & Concentrator-5 kit (ZYMO, R1013), 5’ triphosphates were removed enzymatically ...
-
bioRxiv - Systems Biology 2020Quote: ... and then recovered with RNA Clean and Concentrator-5 spin columns (Zymo; R1015).
-
bioRxiv - Synthetic Biology 2020Quote: ... PCR products were purified by column with Zymo DCC-5 Kit (Zymo Research), then analyzed on a 0.8% agarose/TE gel ...
-
bioRxiv - Immunology 2020Quote: ... DNA was purified using the DNA Clean and Concentrator-5 kit (Zymo Research) and barcoding was performed using Illumina compatible index primers designed according to Buenrostro et al ...
-
bioRxiv - Genomics 2021Quote: ... 10% and 5% methylated (DNAm-10pct and DNAm-5pct) and unmethylated (ZYMO-UM). The negative control (ZYMO-UM ...
-
bioRxiv - Genetics 2020Quote: ... and purified by RNA clean and concentrator-5 kit (Zymo Research, CA, USA) according to the manufacturer’s instructions ...
-
bioRxiv - Evolutionary Biology 2021Quote: ... followed by RNA purification with the RNA Clean & Concentrator-5 kit (Zymo Research) according to the manufacturer’s protocol ...
-
bioRxiv - Genomics 2020Quote: ... The RNA was isolated using the RNA Clean & Concentrator-5 Kit (R1013, Zymo) according to manufacturer’s instructions.
-
bioRxiv - Evolutionary Biology 2020Quote: ... sgRNAs were purified using an RNA Clean and Concentrator 5 kit (Zymo Research), eluted with nuclease-free water ...
-
bioRxiv - Genomics 2020Quote: ... and purified the reaction using the DNA Clean and Concentrator-5 kit (Zymo).
-
bioRxiv - Molecular Biology 2020Quote: ... RNA was then purified using the RNA Clean & Concentrator-5 Kit (Zymo Research), according to manufacturer’s instructions ...
-
bioRxiv - Molecular Biology 2023Quote: ... Converted RNA was purified using the RNA Clean & Concentrator-5 (#R1015, Zymo Research).
-
bioRxiv - Microbiology 2023Quote: ... the raw DNA extractions were concentrated with Clean & Concentrator-5 (Zymo Research, USA), eluting in 24 μL DNA elution buffer (10 mM Tris ...
-
bioRxiv - Systems Biology 2023Quote: ... We performed gel extraction using the DNA Clean & Concentrator-5 Kit (Zymo, #D4014) and eluted in 20 μL MB H2O ...
-
bioRxiv - Developmental Biology 2023Quote: ... Obtained sgRNA mix was purified using RNA Clean and Concentrator-5 (Zymo Research). Injections were performed as before with the exception that 60 μM sgRNA mix was combined with diluted 10 μM Cas9 protein to reach final ∼5 μM RNP complex concentration (molar ratio 6:1 ...
-
bioRxiv - Molecular Biology 2023Quote: ... and purified with the DNA Clean and Concentrator kit (DCC-5, Zymo Research) to rid of any traces of primers and free adapters ...
-
bioRxiv - Genomics 2023Quote: ... DNA fragments were purified using the DNA Clean & Concentrator-5 Kit (Zymo, D4014) according to the manufacturer’s procedures ...
-
bioRxiv - Cell Biology 2023Quote: ... Transposed DNA was purified using a DNA Clean & Concentrator-5 kit (Zymo Research) in 10 µl nuclease-free H2O and amplified with NEBNext® High-Fidelity 2X PCR Master Mix and 1 ul of primer pair from Diagenode (24 SI for tagmented libraries ...
-
bioRxiv - Biophysics 2023Quote: ... The cDNA was purified using Zymo oligo clean and concentrator-5 kit (Zymo). To prepare dsDNA for sequencing ...
-
bioRxiv - Microbiology 2023Quote: ... Ribo-depleted RNA was concentrated using the RNA Clean & Concentrate Kit-5 (ZYMO), and integrity and concentrations of the ribo-depleted RNA checked using a High sensitivity RNA Tape (Agilent ...
-
bioRxiv - Synthetic Biology 2023Quote: ... and purification was performed using the column-based DNA Clean & Concentrator 5 (Zymo) with elution in 7uL dH2O ...
-
bioRxiv - Genomics 2023Quote: ... DNA was extracted with the DNA Clean and Concentrator-5 Kit (Zymo Research). Sequencing adapters were attached to the transposed DNA fragments using NEBNext Ultra II Q5 PCR mix (New England Biolabs) ...
-
bioRxiv - Genomics 2023Quote: ... and clean up with the ChIP DNA Clean & Concentrator-5 kit (Zymo, D5205). DNA was quantified by Qubit dsDNA high sensitivity kit ...
-
bioRxiv - Genomics 2023Quote: ... and then cleaned up with the DNA Clean & Concentrator-5 kit (Zymo, D4013) and eluted in 21 ul 10 mM Tris-HCl pH 8 ...
-
bioRxiv - Microbiology 2022Quote: ... DNA was purified using the DNA Clean and Concentrator-5 kit (Zymo Research), according to the manufacturer’s instructions ...
-
bioRxiv - Molecular Biology 2022Quote: ... RNA was purified using the RNA Clean & Concentrator-5 Kit (Zymo Research, R1015). 1 ug of RNA was denatured at 95°C for 1 minute and subsequently refolded by incubating in 340mM sodium cacodylate buffer (Electron Microscopy Sciences ...
-
bioRxiv - Evolutionary Biology 2024Quote: ... followed by a clean-up using the DNA Clean & Concentrator-5 kit (Zymo). For library generation ...
-
bioRxiv - Developmental Biology 2024Quote: ... which was then purified using the RNA Clean and Concentrator-5 kit (Zymo). Purified probes were quantified by nanodrop ...
-
bioRxiv - Genetics 2023Quote: ... Small RNAs (<200nt) size-fractionated using RNA Clean & Concentrator 5 column kits (Zymo), as per the manufacturer’s instructions ...
-
bioRxiv - Genetics 2023Quote: ... and RNA was purified with the RNA clean & concentrator-5 kit (Zymo research), and equivalent amounts of RNA per replicate were used for cDNA library construction ...
-
bioRxiv - Genomics 2023Quote: ... samples were placed on ice and 5 volumes of DNA Binding Buffer (Zymo) were added to each ...
-
bioRxiv - Genomics 2023Quote: ... Reactions were cleaned up with DNA Clean and Concentrator 5 columns (Zymo Research). Illumina Nextera DNA Unique Dual Indexes Set C (Illumina ...
-
bioRxiv - Synthetic Biology 2024Quote: ... PCR products were purified using the DNA Clean & Concentrator-5 Kit (Zymo Research) or the Zymoclean Gel DNA Extraction Kit (Zymo Research ...
-
bioRxiv - Cell Biology 2024Quote: ... biotinylated RNA was purified using RNA Clean & Concentrator-5 kit (Zymo Research, R1013).
-
bioRxiv - Molecular Biology 2023Quote: ... the fragmented mRNA was purified using RNA Clean & Concentrator-5 kit (Zymo Research). For m1A immunoprecipitation ...
-
bioRxiv - Molecular Biology 2023Quote: ... the DNA was purified using the DNA Clean & Concentrator-5 Kit (Zymo Research) according to the manufacturer’s protocol ...
-
bioRxiv - Molecular Biology 2023Quote: ... RNAs were then purified with the RNA Clean and Concentrator-5 Kit (Zymo). In order to verify the integrity of the in vitro transcribed mRNAs ...
-
bioRxiv - Molecular Biology 2023Quote: ... The samples were cleaned with DNA Clean & Concentrator-5 (Zymo Research, Cat# ZD4014) and eluted in ∼10-30 μl nuclease free water ...