Labshake search
Citations for Zymo Research :
451 - 500 of 1213 citations for 1R 2S 6R 7S 4 4 DIMETHYL 3 5 DIOXA 8 AZATRICYCLO 5.2.1.0 2 6 DECAN 9 ONE since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Genomics 2024Quote: ... The pre-adenylated linker was eluted in 6 µl H2O following the clean-up using the Oligo Clean & Concentrator Kit (Zymo Research, D4060).
-
bioRxiv - Synthetic Biology 2022Quote: ... 10 µL of Mag-Binding beads (Zymo Research, #D4100-2-24) was added and the sample was incubated for 3 min at room temperature ...
-
bioRxiv - Cell Biology 2020Quote: RNA was extracted from 3 x 105 Raji cells using Direct-zolTM RNA MiniPrep kit (Zymo Research) according to manufacturers’ instructions ...
-
bioRxiv - Cancer Biology 2021Quote: ... 3 aliquots were collected in 1 ml stabilization buffer tubes (DNA/RNA Shield, Zymo Research, Irvine, California) using sterile swabs ...
-
bioRxiv - Physiology 2024Quote: ... and KI-TTL mice (N=3 per group) using the Direct-zol RNA Microprep Kit (Zymo Research) followed by a DNase digestion step ...
-
bioRxiv - Molecular Biology 2024Quote: ... The band at roughly 3 kb was extracted using a Zymoclean Gel DNA Recovery Kit (Zymo Research) according to the manufacturer’s protocol ...
-
bioRxiv - Genetics 2021Quote: ... We purified reactions using Zymo DNA Clean and Concentrator-5 kit (Zymo D4013) following manufacturer protocols and eluted with 10.5μL water to recover 10μL ...
-
bioRxiv - Molecular Biology 2021Quote: ... and RNA was selectively recovered with RNA clean and concentrator-5 (Zymo Research). RNA fragments were then 5’ phosphorylated with T4 polynucleotide kinase in T4 PNK buffer ...
-
bioRxiv - Developmental Biology 2020Quote: ... and further purified using the RNA Clean & Concentrator-5 kit (Zymo Research, R1013). Samples were treated 30 minutes with TURBO DNase per manufacturer protocol (Thermo Fisher ...
-
bioRxiv - Molecular Biology 2021Quote: ... DNA was purified with a DNA Clean & Concentrator-5 Kit (Zymo Research, D4013) according to the manufacturer’s protocol ...
-
bioRxiv - Molecular Biology 2020Quote: ... The RNA purification was performed using RNA Clean & Concentrator-5 kit (Zymo Research) as described by manufacturer ...
-
bioRxiv - Genomics 2020Quote: ... gDNA fragments were purified using the DNA Clean & Concentrator-5 kit (Zymo Research).
-
bioRxiv - Genetics 2021Quote: ... RNA samples were purified with an RNA Clean & Concentrator-5 (Zymo Research, R1015), and cDNA generated as described ...
-
bioRxiv - Genetics 2020Quote: ... Tagged DNA was purified with the DNA Clean & Concentrator-5 kit (Zymo Research) eluting with 14 µl EB buffer (Qiagen) ...
-
bioRxiv - Cancer Biology 2020Quote: ... The cDNA products were concentrated using cDNA Clean & Concentrator-5 Kit (Zymo Research) followed bead cleanup using 0.6X AMPure XP Beads (Beckman Coulter ...
-
bioRxiv - Synthetic Biology 2021Quote: ... These libraries were purified using the DNA Clean & Concentrator™-5 kit (Zymo) and eluted in water ...
-
bioRxiv - Synthetic Biology 2021Quote: ... The resulting crRNA was purified using RNA Clean & ConcentratorTM-5 kit (Zymo Research), and subsequently quantified using a NanoDrop 2000 spectrophotometer (Thermo Fisher Scientific) ...
-
bioRxiv - Microbiology 2020Quote: ... RNA was cleaned using the Zymo Clean and Concentrate 5 column (Zymo Research) and eluted in 2x 20 μL (final 40 μL) ...
-
bioRxiv - Genomics 2021Quote: ... Reactions were pooled and purified by DNA Clean and Concentrator 5 (Zymo Research). pLCv2-opti-stuffer-mCherry was digested as described 41 ...
-
bioRxiv - Neuroscience 2022Quote: ... the product was purified with the DNA Clean & Concentrator-5 Kit (Zymo Research). 20 μl tagmented DNA was PCR amplified with NEBNext High-Fidelity PCR Master mix and forward and reverse UDI primers ...
-
bioRxiv - Developmental Biology 2022Quote: Linearized plasmid DNA was cleaned using DNA Clean & concentrator-5 (Zymo Research #D4014). In situ hybridization was completed according to a standard protocol (Cunningham and Monk ...
-
bioRxiv - Molecular Biology 2022Quote: ... The product was cleaned up using RNA Clean & Concentrator-5 kit (ZYMO, R1013) and added into 20 μl of reverse transcription and strand-switching reaction containing 100 nM custom primer (5’ - phos/ ACTTGCCTGTCGCTCTATCTTCATTGATGGTGCCTACAG - 3’) ...
-
bioRxiv - Molecular Biology 2022Quote: ... rRNA-depleted RNA was purified by RNA Clean & Concentrator-5 kit (ZYMO, R1013) and then ligated to 50 pmol 3’ adapter (5’-rAppCTGTAGGCACCATCAAT - NH2-3’ ...
-
bioRxiv - Microbiology 2022Quote: ... The DMS-modified RNA was purified using RNA Clean and ConcentratorTM-5 (Zymo) and eluted in 10µl water.
-
bioRxiv - Genetics 2022Quote: ... followed by another round of clean up (Zymo RNA Clean and Concentrator 5). The final sequence of the spike-in mRNA is ...
-
bioRxiv - Bioengineering 2022Quote: ... DNA products were purified using the DNA Clean & Concentrator-5 Kit (Zymo Research). All purified PCR products were visually checked for expected size via 1% agarose gel electrophoresis and assessed for purity and yield via Nanodrop (Thermo Fisher Scientific).
-
bioRxiv - Microbiology 2020Quote: ... and subsequently purified using the RNA Clean and Concentrate −5 kit (Zymo Research). RNA was then prepped for deep-sequencing using the TruSeq Stranded mRNA Library Preparation Kit (Illumina ...
-
bioRxiv - Plant Biology 2021Quote: ... The remaining RNA was recovered with RNA Clean & Concentrator-5 (Zymo Research, USA). RNA fragments ranging from 200–1000 nucleotides in size were validated on an Agilent 2100 Bioanalyzer.
-
bioRxiv - Molecular Biology 2022Quote: ... Eluted RNA was purified with Zymo RNA Clean & Concentrator-5 columns (Zymo Research), reverse-transcribed with SuperScript IV (ThermoFisher Scientific) ...
-
bioRxiv - Microbiology 2022Quote: ... the RNA was purified using the RNA Clean & Concentrator-5 kit (Zymo Research). The 3’ barcoded adaptors were ligated onto the RNA by mixing 5 µl of the dephosphorylated RNA with 100 µM of the barcoded adaptor and heating for 2 min at 70°C before transfer to ice ...
-
bioRxiv - Biochemistry 2022Quote: ... followed by column purification using RNA Clean & Concentrator Kit-5 (R1015, Zymo Research). End-repaired RPFs RNA were eluted in 20 µL of nuclease-free water ...
-
bioRxiv - Biochemistry 2022Quote: ... RNAs were further purified through RNA Clean and Concentrator-5 (R1013, Zymo Research) and eluted in 8 μL ...
-
bioRxiv - Microbiology 2022Quote: ... After reaction clean-up using ZYMO RNA Clean & Concentrator-5 kit (ZYMO, R1013), 5’ triphosphates were removed enzymatically ...
-
bioRxiv - Systems Biology 2020Quote: ... and then recovered with RNA Clean and Concentrator-5 spin columns (Zymo; R1015).
-
bioRxiv - Synthetic Biology 2020Quote: ... PCR products were purified by column with Zymo DCC-5 Kit (Zymo Research), then analyzed on a 0.8% agarose/TE gel ...
-
bioRxiv - Immunology 2020Quote: ... DNA was purified using the DNA Clean and Concentrator-5 kit (Zymo Research) and barcoding was performed using Illumina compatible index primers designed according to Buenrostro et al ...
-
bioRxiv - Genomics 2021Quote: ... 10% and 5% methylated (DNAm-10pct and DNAm-5pct) and unmethylated (ZYMO-UM). The negative control (ZYMO-UM ...
-
bioRxiv - Genetics 2020Quote: ... and purified by RNA clean and concentrator-5 kit (Zymo Research, CA, USA) according to the manufacturer’s instructions ...
-
bioRxiv - Evolutionary Biology 2021Quote: ... followed by RNA purification with the RNA Clean & Concentrator-5 kit (Zymo Research) according to the manufacturer’s protocol ...
-
bioRxiv - Genomics 2020Quote: ... The RNA was isolated using the RNA Clean & Concentrator-5 Kit (R1013, Zymo) according to manufacturer’s instructions.
-
bioRxiv - Evolutionary Biology 2020Quote: ... sgRNAs were purified using an RNA Clean and Concentrator 5 kit (Zymo Research), eluted with nuclease-free water ...
-
bioRxiv - Genomics 2020Quote: ... and purified the reaction using the DNA Clean and Concentrator-5 kit (Zymo).
-
bioRxiv - Molecular Biology 2020Quote: ... RNA was then purified using the RNA Clean & Concentrator-5 Kit (Zymo Research), according to manufacturer’s instructions ...
-
bioRxiv - Genomics 2022Quote: ... Amplified DNA was cleaned up using a Clean & Concentrator-5 kit (D4013, Zymo) and then digested with 1 μl BsrDI (R0574S ...
-
bioRxiv - Bioengineering 2022Quote: ... With RNA pre-cleaned using the RNA clean-and-concentrator-5 kit (Zymo), and denatured by addition of 1x RNA loading dye (NEB ...
-
bioRxiv - Developmental Biology 2022Quote: ... Transposed DNA was purified using the Zymo Clean and Concentrator-5 kit (Zymo) according to the manufacturer’s protocol and eluted in 21ml of elution buffer ...
-
bioRxiv - Developmental Biology 2022Quote: ... The ligated product was isolated using RNA Clean & Concentrator-5 (Zymo Research, R1016) to retain ≥ 200-nt RNAs and reverse transcribed in 25 μl with 50 pmol RT primer (GCA CCC GAG AAT TCC ANN NNN NNN ...
-
bioRxiv - Cell Biology 2022Quote: ... RNA was then concentrated with RNA Clean & Concentrator™-5 columns (Zymo R1015), quantified by Nanodrop and Agilent Bioanalyzer assays ...
-
bioRxiv - Cell Biology 2022Quote: ... RNA was then concentrated with RNA Clean & Concentrator™-5 columns (Zymo R1015), quantified by Nanodrop and Agilent Bioanalyzer assays ...
-
bioRxiv - Molecular Biology 2022Quote: ... The RNA was purified using an RNA Clean & Concentrator-5 Kit (Zymo Research) and eluted into 10 µL H2O.