Labshake search
Citations for BestGene :
1 - 50 of 111 citations for WAS Protein Family Member 3 WASF3 Antibody Biotin since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cell Biology 2019Quote: The optimal sgRNA in pCFD3: U6:3-gRNA vector was microinjected into embryos (BestGene, Inc) to create a transgenic fly constitutively expressing the Rpl13a-specific sgRNA ...
-
bioRxiv - Cell Biology 2019Quote: ... UASp-CFP-Msps plasmid was injected into embryos for targeted insertion on chromosome 3 at ZH-96E by Bestgene, Inc.
-
bioRxiv - Neuroscience 2021Quote: ... RNAi-RIM-BP flies have been obtained after design of the RNAi sequence by our laboratory (Forward: 5’-CTAGCAGTGGGCACCGACAATCAGCCACCT AGTTATATTCAAGCATAGGTGGCTGATTGTCGGTGCCCGCG-3’; Reverse: 5’-AATTC GCGGGCACCGACAATCAGCCACCTATGCTTGAATATAACTAGGTGGCTGATTGTG GTGCCCACTG-3’) and injection by BestGene Inc ...
-
bioRxiv - Cell Biology 2023Quote: ... The DNA plasmid of pScarlessHD-5’ msps homology arm-C-3xVHH05-6XMS2-DsRed-3’ msps homology arm was co-injected with pCFD5-gRNA#1 and pCFD5-gRNA#2 by BestGene. Flies with fluorescent red eyes were selected and crossed with Tub-PBac flies to remove the DsRed region by PBac transposase ...
-
bioRxiv - Neuroscience 2019Quote: ... and the resulting hs-svr1A-2-3-t2 construct was introduced into the germline of w1118 flies by BestGene (Chino Hills, CA, USA) using standard P-element transformation ...
-
bioRxiv - Neuroscience 2019Quote: ... Transgenic flies with site-specific insertions at VK0005 site on chromosome 3 were generated using standard microinjection (BestGene, Inc.).
-
bioRxiv - Neuroscience 2021Quote: ... Transgenic flies were generated via standard procedures and φc31-mediated transposition into the Drosophila genome at the VK00027 landing site located on chromosome 3 (BestGene Inc.). To select larvae of the correct genotype for immunhistochemistry and behavior assays ...
-
bioRxiv - Animal Behavior and Cognition 2020Quote: ... UAS-HA-YTHDF and UAS-HA-YTHDF-3A (described above) were injected into w[1118] with Δ2-3 helper plasmid to obtain transformants (Bestgene, Inc.) Flies were raised on standard cornmeal-based food medium containing 1.25% w/v agar ...
-
bioRxiv - Developmental Biology 2021Quote: ... These transgenes were integrated at ZH-86Fb site on chromosome 3 using φC31-mediated integration (Bischof and Basler, 2008) (BestGene, Chino Hills, CA). Worniu-Gal4 ...
-
bioRxiv - Developmental Biology 2021Quote: ... The various transgenic reporters were integrated into the VK31 site on chromosome 3 using φC31-mediated integration (Bischof and Basler, 2008) (BestGene, Chino Hills, CA).
-
bioRxiv - Developmental Biology 2022Quote: ... These transgenes were integrated at ZH-86Fb site on chromosome 3 using φC31-mediated integration (Bischof and Basler 2008) (BestGene, Chino Hills, CA). The Wor-Gal4 ...
-
bioRxiv - Neuroscience 2022Quote: ... was microinjected (Bestgene, Inc) into MiMIC line ...
-
bioRxiv - Developmental Biology 2019Quote: ... Injection was performed by Bestgene in the yw ...
-
bioRxiv - Developmental Biology 2020Quote: ... Injection was performed by Bestgene in the yw ...
-
bioRxiv - Developmental Biology 2020Quote: ... myoCR2 was generated by BestGene Inc by CRISPR-mediated mutagenesis using 5’-CTTCGACTATTCACCGCGCTATTA-3’ as a guide RNA ...
-
bioRxiv - Developmental Biology 2022Quote: ... Transgenesis was performed by BestGene or Rainbow transgenesis services.
-
bioRxiv - Neuroscience 2021Quote: ... The plasmid was injected by Bestgene into the attP2 background (BL 8622) ...
-
bioRxiv - Cell Biology 2021Quote: ... This construct was injected by BestGene in order to generate transgenic lines.
-
bioRxiv - Neuroscience 2020Quote: ... The construct was injected by BestGene Inc ...
-
bioRxiv - Physiology 2022Quote: ... Injection was carried out by Bestgene, California ...
-
bioRxiv - Genetics 2021Quote: ... germline transformation was performed by Bestgene Inc ...
-
bioRxiv - Developmental Biology 2023Quote: This plasmid was injected by BestGene using P-element insertion.
-
bioRxiv - Developmental Biology 2019Quote: ... The final construct was injected (BestGene Inc.) and two insertions on 2nd (tdBcd(II) ...
-
bioRxiv - Cell Biology 2023Quote: ... All embryos microinjections was performed by BestGene Inc.
-
bioRxiv - Cell Biology 2022Quote: ... The UAS driven siRNA was inserted by BestGene Inc ...
-
bioRxiv - Molecular Biology 2020Quote: ... The TaDaG2-MRG15 line was generated by BestGene, Inc (CA) ...
-
bioRxiv - Cell Biology 2020Quote: ... Embryo injections and transformant selection was performed by BestGene Inc ...
-
Axon-secreted chemokine-like Orion is a signal for astrocyte infiltration during neuronal remodelingbioRxiv - Neuroscience 2020Quote: ... Construct injection was performed by Bestgene (Chino Hills, CA) and all the transgenes were inserted into the same attP site (VK00027 at 89E11) ...
-
bioRxiv - Cell Biology 2021Quote: ... and was injected into P{CaryP}attP2 (BestGene Inc.).
-
bioRxiv - Neuroscience 2023Quote: ... Construct injection was performed by Bestgene (Chino Hills, CA) and all the transgenes were inserted into the same attP site (VK00027 at 89E11) ...
-
bioRxiv - Neuroscience 2023Quote: ... This construct was injected into w1118 embryos (Bestgene, Inc).
-
bioRxiv - Developmental Biology 2020Quote: ... Injection and creation of attp40 transgenics was done by BESTGENE Inc ...
-
bioRxiv - Developmental Biology 2022Quote: ... Verified plasmid was then injected into embryos (BestGene Inc. Co) and a stable transgenic line made.
-
bioRxiv - Evolutionary Biology 2022Quote: ... simulans w[XD1] wild-type strain was obtained from BestGene, Inc ...
-
bioRxiv - Neuroscience 2022Quote: ... the construct was microinjected into w1118 fly embryos (Bestgene, Inc). Transgenic FLAG-PGA expression was confirmed by FLAG Western blotting of adult head extracts after crossing all generated UAS-PGA lines to Actin5C-GAL4 (ubiquitous) ...
-
bioRxiv - Genetics 2024Quote: ... The resulted plasmid was inserted into attP2 site (Bestgene Inc.) using PhiC31 integrase-mediated-specific transformation to generate the transgene P[CG1603gDNA].
-
bioRxiv - Genetics 2022Quote: ... The plasmid was then assembled and injected into embryos (BestGene Inc.).
-
bioRxiv - Developmental Biology 2020Quote: ... Injection of these plasmids into Drosophila embryos was conducted by BestGene Inc.
-
bioRxiv - Developmental Biology 2023Quote: ... The plasmid mixture was injected (Rainbow Flies, Inc or BestGene, Inc) into the relevant host fly strain expressing Vasa-Cas9 (Sebo et al ...
-
bioRxiv - Genetics 2023Quote: ... LexAop-nAChRβ3 was also integrated into the VK27 site by BestGene Inc ...
-
bioRxiv - Genetics 2024Quote: ... UASz-CG1603 was inserted into either attP2 or attP40 (Bestgene Inc.) using PhiC31 integrase-mediated site-specific transformation ...
-
bioRxiv - Neuroscience 2023Quote: ... The pCFD4d plasmid was injected into vas-Cas9 flies by BestGene Inc ...
-
bioRxiv - Developmental Biology 2021Quote: ... injection of both vectors and fly screening was carried out by BestGene.
-
bioRxiv - Neuroscience 2021Quote: ... melanogaster germline transformation with the prepared plasmid was carried out by BestGene using the PhiC31 integration + Cre-loxP removal plan (Bestgene ...
-
bioRxiv - Cell Biology 2020Quote: ... Site-specific attp40 insertion into the fly genome was performed by Bestgene, Inc.
-
bioRxiv - Neuroscience 2020Quote: ... This plasmid was used to generate transgenic flies (Bestgene, Chino Hills, CA) with the construct integrated into the VK00037 docking site.
-
bioRxiv - Neuroscience 2022Quote: ... The construct was inserted into attP40 by phiC31-mediated transgenesis (BestGene Inc.).
-
bioRxiv - Neuroscience 2022Quote: ... The construct was inserted into attP2 by phiC31-mediated transgenesis (BestGene Inc.).
-
bioRxiv - Neuroscience 2022Quote: ... The construct was inserted into attP40 by phiC31 -mediated transgenesis (BestGene Inc.).
-
bioRxiv - Neuroscience 2022Quote: ... The transgenic line was generated in the VK00027 locus (BestGene Inc., USA). Sources of the fly strains are listed in Table 1.