Labshake search
Citations for Eppendorf :
1 - 50 of 368 citations for Recombinant Human Ribulose 5 Phosphate 3 Epimerase His tagged since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Biophysics 2019Quote: ... The His-SUMO solubility tag was cleaved using His-tagged SUMO protease (from RGO) by incubating at 4°C overnight while gently rocking in protein lobind tubes (Eppendorf). The flow through of the second affinity step was collected and concentrated prior to loading onto a Superdex S200 (26/60 ...
-
bioRxiv - Neuroscience 2021Quote: ... EGFP RVS 5’-3’= TGTGGCGGATCTTGAAGTTAG on a Mastercycler Pro (Eppendorf) thermocycler PCR machine ...
-
bioRxiv - Molecular Biology 2020Quote: ... one milliliter of NS1 recombinant protein (3 mg/ml in 2x PBS) was placed into a 1.5 ml Eppendorf tube (Eppendorf, Germany); and the tube mixed for 66 hours (55°C ...
-
bioRxiv - Cell Biology 2022Quote: Samples were incubated on a rotator for 5 min at 4°C and then centrifuged at 500g for 5 min (Eppendorf, 5920R; 4°C, ramp speed of 3/3). Supernatant was removed and pellet was resuspended in sort buffer [1mM EDTA (Invitrogen ...
-
bioRxiv - Biochemistry 2021Quote: Parasites were cultured in 5% 0+ human erythrocytes (Blood bank, Universitätklinikum Hamburg Eppendorf) in RPMI medium supplemented with 0.5% Albumax at 37°C in an atmosphere of 1% O2 ...
-
bioRxiv - Neuroscience 2020Quote: ... Microinjection of 300 nl was made over 3 min using a Femtojet injector (~5 psi, Eppendorf), and the exposed cortical surface was covered by a sterilized round cover glass (3 or 4 mm in diameter ...
-
bioRxiv - Plant Biology 2023Quote: ... Bound phosphopeptides were then eluted 3 times with 100 µL ammonium hydroxide (5% v/v) into 1.5mL Lo-Bind tubes (Eppendorf). These were then frozen and lyophilized ...
-
bioRxiv - Cell Biology 2021Quote: ... were vortexed 3 min at room temperature followed by centrifugation at 4,500 x g for 5 min at 4°C (Eppendorf #5010R). The supernatant fluid was poured into a chilled 2 ml screw-capped tube ...
-
bioRxiv - Biochemistry 2021Quote: ... Cells were maintained in a humidified atmosphere of 5% CO2 and 37 °C and were passaged every 2-3 days into 10 cm polystyrene coated plates (Eppendorf; EP0030700112-300EA) upon reaching high density ...
-
bioRxiv - Developmental Biology 2023Quote: ... the gRNA:Cas9 ribonucleoprotein complex solution was incubated at 37°C for 5 min and then backfilled into 3 microinjection needles using an Eppendorf GELoader tip (Eppendorf, Cat# 022351656). After loading embryos into the embryo holder which covered with 12.5 ppt of salinity water with 0.0001% of methylene blue ...
-
bioRxiv - Molecular Biology 2023Quote: ... FLAG-tagged Z-B dimers (to 25 nM in 25 µL) in a 1.5-mL LoBind tube (Eppendorf). Then canonical nucleosomes (from native or recombinant source ...
-
bioRxiv - Cell Biology 2021Quote: ... 3-liter Bioflo 110 (Eppendorf) were used ...
-
bioRxiv - Immunology 2023Quote: ... and aliquoted/stored in Dulbecco’s phosphate buffered saline (DPBS) at -80 °C in protein LoBind tubes (Eppendorf).
-
bioRxiv - Microbiology 2022Quote: ... The plasmids encoding wild type Rac1 tagged with GFP (Rac1-wt-GFP) and Rac1-T17N tagged with GFP (Rac1-DN-GFP) were kindly provided by Stefan Linder (University Hospital Hamburg-Eppendorf, Germany).
-
bioRxiv - Cell Biology 2020Quote: ... and 5 % CO2 (Eppendorf). Jurkat CD4-KO cells were derived from wild-type Jurkat T cells (clone E6 ...
-
bioRxiv - Biophysics 2020Quote: 5) Centrifuge (Eppendorf, 5810R)
-
bioRxiv - Neuroscience 2020Quote: ... centrifuged (16000 g, 3 min, 5415R, Eppendorf) and re-suspended in fresh medium ...
-
bioRxiv - Cancer Biology 2021Quote: ... 1 mM β-glycerol phosphate and 2.5 mM Na2H2P2O7).) and cells scraped and transferred into Protein Lo-bind tubes (Eppendorf). Samples were sonicated for 10 cycles (30s on & 40s off ...
-
bioRxiv - Cell Biology 2022Quote: ... Sorted nuclei were then centrifuged at 1000 g for 15 min (Eppendorf, 5920R; 4°C, ramp speed of 3/3), and supernatant was removed ...
-
bioRxiv - Neuroscience 2023Quote: ... 5 % CO2 using microloaders (Eppendorf). Slices were placed into the incubation chambers one at a time (minimum volume 1.5 ml to cover raised grid) ...
-
bioRxiv - Biochemistry 2023Quote: ... The cellulase-LPMO synergy was assessed by performing reactions with crystalline Avicel (1 % w/v) in 50 mM sodium phosphate buffer (pH 6.0) using a thermomixer (Eppendorf, Hamburg, Germany) incubated at 30 °C with horizontal agitation (1000 rpm) ...
-
bioRxiv - Neuroscience 2023Quote: ... insoluble PFF were produced by incubation of 300 µM recombinant α-syn in a LoBind reaction tube (Eppendorf GmbH, GE) with one borosilicate glass bead (d = 3.0 mm ...
-
bioRxiv - Cell Biology 2023Quote: ... transferred in 5 ml tubes (Eppendorf) and 480 μl Triton-X-100 (2% [vol/vol] final concentration ...
-
bioRxiv - Animal Behavior and Cognition 2024Quote: ... dsRNA was injected at a concentration of 1000 ng/μL dissolved in Phosphate-buffered saline (PBS) using a microliter injector (FemtoJet, Eppendorf AG, Hamburg, Germany) and borosilicate glass capillaries (100 mm length ...
-
bioRxiv - Immunology 2020Quote: Using 5 mL lo-bind tubes (Eppendorf), 960 μL of ice-cold methanol was added to ~1 mL of protein supernatant and vortexed briefly before subsequent addition of 160 μL of ice-cold chloroform and thorough mixing ...
-
bioRxiv - Neuroscience 2024Quote: ... placed in 5-ml tubes (Eppendorf, 0030119452) and dehydrated 1h in each methanol baths (50% ...
-
bioRxiv - Bioengineering 2022Quote: ... Subsequent washes were performed at a volume of 5 mL in 5 mL Eppendorf tubes (Cat. No. 0030122321, Eppendorf) and pelleted with a compatible microcentrifuge (MC-24™ Touch ...
-
bioRxiv - Cell Biology 2023Quote: ... human lung primary cells were processed in 1.5 ml DNA LoBind tubes (Eppendorf), washed in PBS via centrifugation at 400g for 5 min at 4 °C and lysed for 3 min on ice before washing via centrifugation at 500g for 5 min at 4 °C ...
-
bioRxiv - Genomics 2021Quote: ... Nuclei were rotated at 4 °C for 5 minutes before being pelleted again with a swinging bucket centrifuge (500 x g, 5 min, 4°C; 5920R, Eppendorf). After centrifugation ...
-
bioRxiv - Genomics 2021Quote: ... nuclei were rotated at 4 °C for 5 minutes before being pelleted again with a swinging bucket centrifuge (500 x g, 5 min, 4°C; 5920R, Eppendorf). After centrifugation ...
-
bioRxiv - Genomics 2019Quote: ... incubated for 5 min at 4 °C with rotation and pelleted again (500 x g, 5 min, 4°C; 5920R, Eppendorf). Nuclei were resuspended in 500 μL high salt tagmentation buffer (36.3 mM Tris-acetate (pH = 7.8) ...
-
bioRxiv - Microbiology 2019Quote: ... in a 5 mL tube (Eppendorf, Hamburg, Germany). Tubes were kept as cold as possible while in the field (usually for less than 8 h ...
-
bioRxiv - Developmental Biology 2019Quote: ... at 5% CO2 (Eppendorf® New Brunswick Galaxy170S). Media was changed every day and cells were passaged upon reaching 80% confluence ...
-
bioRxiv - Cell Biology 2019Quote: ... shaked for 5 min on a thermomixer (Eppendorf) at room temperature and centrifuged for 20 min at 4°C full speed ...
-
bioRxiv - Microbiology 2023Quote: ... vortexed for 5 min and then centrifuged (Eppendorf Centrifuge model 5810 R ...
-
bioRxiv - Microbiology 2023Quote: ... centrifuging for 5 min at 7,500 rcf (Eppendorf, tabletop centrifuge MiniSpin plus with rotor F-45-12-11) ...
-
bioRxiv - Microbiology 2020Quote: ... including human and microbial cells (4°C, Eppendorf 5810R centrifuge, 15 min, 3,220 rcf) represented in the “cell pellet” ...
-
bioRxiv - Cell Biology 2020Quote: ... 5000 rpm for 5 min in 5415D centrifuge (Eppendorf) to remove aggregates.
-
bioRxiv - Genomics 2022Quote: ... typically a 5 mL Lo-bind tube (0030122348, Eppendorf) or 15 mL falcon tube (229410 ...
-
bioRxiv - Neuroscience 2024Quote: ... Samples were pooled in 5 mL LoBind tubes (Eppendorf) in 1 mL chilled lysis buffer (10 mM Tris-HCl ...
-
bioRxiv - Bioengineering 2024Quote: ... centrifuged at 1200 RPM for 5 minutes (Eppendorf 5180) and stained for cell viability using Fixable Live/Dead Blue for 30 min at 4°C ...
-
bioRxiv - Molecular Biology 2022Quote: ... Cell pellets of OD600 = 3-6 units (as measured using an Eppendorf BioPhotometer) were resuspended in 300 µL of 20 % TCA and 100 µL of acid-washed glass beads ...
-
bioRxiv - Synthetic Biology 2022Quote: ... Plates were then centrifuged at 330 rpm for 3 min (Eppendorf, Centrifuge 5810). Plates were then incubated at 37°C for 24 hours ...
-
bioRxiv - Microbiology 2019Quote: ... Loaded microfluidic chambers were centrifuged 3 min at 1000 rcf (Eppendorf centrifuge 5430R) to maximize cell adhesion.
-
bioRxiv - Bioengineering 2022Quote: ... Cells were centrifuged 3 minutes at 800-1000 RPM (Eppendorf 5810 tabletop centrifuge) and resuspended ...
-
bioRxiv - Neuroscience 2022Quote: ... Half medium was changed every 2-3 days using Xplorer multichannel pipettes (Eppendorf) set at lowest speed to not disturb the hostdonor interaction ...
-
bioRxiv - Microbiology 2023Quote: ... qPCR analysis was carried out in 96 well plates using Quantstudio 3 (Eppendorf). Amplification was carried out at 95°C for 15 min and 50 cycles at 95°C for 15s ...
-
bioRxiv - Cancer Biology 2021Quote: ... Tissue homogenates were transferred to 5 mL centrifuge tubes (Eppendorf) and supplemented with 20 U benzonase and 10 U avidin prior to incubating with rotation at 4 °C for 20 min and subsequent removal of debris by centrifugation at 16,000 × g for 15 min.
-
bioRxiv - Bioengineering 2019Quote: ... for 5 minutes at 3,500 RPM (2,465 x g, Eppendorf 5810R v3.3 centrifuge with A-4-62 rotor ...
-
bioRxiv - Cancer Biology 2021Quote: ... at 37°C in a humidified 5% CO2 incubator (Eppendorf). Stable cell lines overexpressing Api5 was prepared using lentiviral-mediated transduction ...