Labshake search
Citations for Eppendorf :
151 - 200 of 256 citations for Recombinant Human Interleukin 3 Receptor Alpha Low Affinity His tagged since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2022Quote: ... Twenty μL of supernatants were used as input controls and stored at −20°C in low-bind tubes (Eppendorf, Enfield, CT). For each sample ...
-
bioRxiv - Systems Biology 2022Quote: ... The polar and the non-polar phase were transferred into two new and separate reaction vials (Eppendorf low binding tube, 1.5 mL, Eppendorf, Hamburg, Germany), evaporated to dryness using an Eppendorf Concentrator Plus (Eppendorf ...
-
bioRxiv - Cancer Biology 2023Quote: ... transferred all the tissue fragments from the Petri dish into a clean 5 mL low-binding tube (Eppendorf, cat. no. 0030108.310), and rotated the tube at 20 rpm at room temperature for 15 min ...
-
bioRxiv - Neuroscience 2023Quote: ... insoluble PFF were produced by incubation of 300 µM recombinant α-syn in a LoBind reaction tube (Eppendorf GmbH, GE) with one borosilicate glass bead (d = 3.0 mm ...
-
bioRxiv - Biochemistry 2021Quote: ... all samples were adjusted to the same volume and concentration (ca. 1 mg/mL) and transferred to protein low-bind microcentrifuge tubes (Eppendorf, Hamburg, Germany). To precipitate the proteins ...
-
bioRxiv - Biophysics 2021Quote: ... Samples of 20 μΜ N-NTD or N-NTD-SR consisting of varied protein:nucleic acid molar ratios (8:1, 4:1, 2:1, 1:1, 1:2) were prepared in low-binding microtubes (Eppendorf® LoBind) in the presence of 10% PEG-4000 (w/v ...
-
bioRxiv - Biophysics 2021Quote: ... The protein samples of N-NTD and N-NTD-SR at 20 µM were prepared in low-binding microtubes (Eppendorf® LoBind) containing 20 mM Tris-HCl buffer (pH 7.5 ...
-
bioRxiv - Developmental Biology 2021Quote: ... 5.5 × 106 cells were suspended in 5.5 ml mTeSR1 per well of 6-well ultra-low attachment plates (Coring Costar) and cultured overnight in an orbital shaking CO2 incubator (Eppendorf New Brunswick) at 95 rpm ...
-
bioRxiv - Cell Biology 2021Quote: ... the Matrigel coat was broken by vigorously pipetting up and down and the healthy organoids were transferred to a 60mm low attachment culture plate (Eppendorf, cat # 003070119). The plates were then moved to a 37°C incubator and to a Celltron benchtop shaker for CO2 incubators (Infors USA ...
-
bioRxiv - Cell Biology 2022Quote: ... The crude extract was centrifuged for 15 min at 13,000 rpm at 4 °C to remove any tissue debris and the clear supernatant was transferred to a fresh Protein Low-Bind tube (Eppendorf, Hamburg, Germany). The total protein content of the samples was estimated using Pierce BCA protein assay kit from Thermo Scientific (Rockford ...
-
bioRxiv - Neuroscience 2022Quote: ... Medium containing viral particles was harvested approximately 72 h later through low-speed centrifugation at 1.500 g in an Eppendorf centrifuge (Eppendorf 5810R, Hamburg, Germany) for 5 min ...
-
bioRxiv - Cell Biology 2023Quote: ... the Matrigel coat was broken by pipetting up and down and the healthy organoids were transferred to a 60mm low attachment culture plate (Eppendorf, cat # 003070119). The plates were then moved to a 37°C incubator and to a Celltron benchtop shaker for CO2 incubators (Infors USA ...
-
bioRxiv - Genomics 2023Quote: ... Approximately 25mg of grey matter from the frontal cortex was chipped on dry ice into prechilled 1.5ml Low bind tubes (Eppendorf, catalogue number: 022431021), kept frozen throughout the process and stored at -80oC ...
-
bioRxiv - Neuroscience 2021Quote: ... EGFP RVS 5’-3’= TGTGGCGGATCTTGAAGTTAG on a Mastercycler Pro (Eppendorf) thermocycler PCR machine ...
-
bioRxiv - Biochemistry 2021Quote: Parasites were cultured in 5% 0+ human erythrocytes (Blood bank, Universitätklinikum Hamburg Eppendorf) in RPMI medium supplemented with 0.5% Albumax at 37°C in an atmosphere of 1% O2 ...
-
bioRxiv - Cell Biology 2023Quote: ... human lung primary cells were processed in 1.5 ml DNA LoBind tubes (Eppendorf), washed in PBS via centrifugation at 400g for 5 min at 4 °C and lysed for 3 min on ice before washing via centrifugation at 500g for 5 min at 4 °C ...
-
bioRxiv - Molecular Biology 2021Quote: ... Flowrate was adjusted at 2 ml/min to collect peptides in 1 ml fractions in low-protein binding Eppendorf tubes (Eppendorf LoBind tubes, cat. no. EPPE0030108.116). The bound complexes were separated from β2 microglobulin and heavy chain using increasing concentration of buffer B ...
-
bioRxiv - Neuroscience 2021Quote: ... were incubated with ten-fold molar excess S-XL6 for 4 hours at 37 °C in protein low bind Eppendorf tubes using Eppendorf Thermomixer at 350 rpm (Eppendorf North America, Enfield, CT, USA). After incubation ...
-
bioRxiv - Cell Biology 2022Quote: Samples were incubated on a rotator for 5 min at 4°C and then centrifuged at 500g for 5 min (Eppendorf, 5920R; 4°C, ramp speed of 3/3). Supernatant was removed and pellet was resuspended in sort buffer [1mM EDTA (Invitrogen ...
-
bioRxiv - Microbiology 2020Quote: ... including human and microbial cells (4°C, Eppendorf 5810R centrifuge, 15 min, 3,220 rcf) represented in the “cell pellet” ...
-
bioRxiv - Molecular Biology 2022Quote: ... Cell pellets of OD600 = 3-6 units (as measured using an Eppendorf BioPhotometer) were resuspended in 300 µL of 20 % TCA and 100 µL of acid-washed glass beads ...
-
bioRxiv - Synthetic Biology 2022Quote: ... Plates were then centrifuged at 330 rpm for 3 min (Eppendorf, Centrifuge 5810). Plates were then incubated at 37°C for 24 hours ...
-
bioRxiv - Microbiology 2019Quote: ... Loaded microfluidic chambers were centrifuged 3 min at 1000 rcf (Eppendorf centrifuge 5430R) to maximize cell adhesion.
-
bioRxiv - Bioengineering 2022Quote: ... Cells were centrifuged 3 minutes at 800-1000 RPM (Eppendorf 5810 tabletop centrifuge) and resuspended ...
-
bioRxiv - Neuroscience 2022Quote: ... Half medium was changed every 2-3 days using Xplorer multichannel pipettes (Eppendorf) set at lowest speed to not disturb the hostdonor interaction ...
-
bioRxiv - Microbiology 2023Quote: ... qPCR analysis was carried out in 96 well plates using Quantstudio 3 (Eppendorf). Amplification was carried out at 95°C for 15 min and 50 cycles at 95°C for 15s ...
-
bioRxiv - Cell Biology 2020Quote: ... falciparum parasites (strain 3D7) were cultured in human RBCs (O+) (transfusion blood, Universitätsklinikum Hamburg Eppendorf, Hamburg). Cultures were maintained at 37° C in an atmosphere of 1% O2 ...
-
bioRxiv - Microbiology 2022Quote: ... falciparum parasites were cultured in human red blood cells (O+ or B+, Universitätsklinikum Eppendorf, Hamburg, Germany) at 5 % haematocrit in an atmosphere of 1% O2 ...
-
High resolution, serial imaging of early mouse and human liver bud morphogenesis in three dimensionsbioRxiv - Developmental Biology 2021Quote: ... Cells were centrifuged 3 minutes at 800-1000 RPM (Eppendorf 5810 table top centrifuge) and resuspended ...
-
bioRxiv - Genomics 2020Quote: ... 3 ml of each bacterial suspension were centrifuged at 6,000 × g (Eppendorf, Westbury, NY) for 2 mins ...
-
bioRxiv - Plant Biology 2020Quote: ... The homogenates were centrifuged at 1,000 g for 3 min (Eppendorf 5430, Hamburg, Germany). The subsequent steps of the RNA extraction were performed on the supernatants according to the manufacturer’s specifications ...
-
bioRxiv - Molecular Biology 2019Quote: ... The peptide rOv-GRN-1was concentrated using Centripep with cut-off 3 kDa (Eppendorf) and resuspended in low salt solution ...
-
bioRxiv - Systems Biology 2019Quote: ... and 74.9 °C for 3 minutes in a thermocycler (Mastercycler Pro, Eppendorf, Hamberg, Germany) system as described elsewhere (Jafari et al. ...
-
bioRxiv - Biochemistry 2022Quote: ... for 3 min and then reduced to dryness in a Vacufuge centrifugal concentrator (Eppendorf).
-
bioRxiv - Cell Biology 2023Quote: Human erythrocytes (blood group 0+ donated from the blood bank of the University Medical Center Hamburg-Eppendorf) and trophozoites to be examined were washed twice with incomplete TY-I-S-33 medium (200 x g ...
-
bioRxiv - Cell Biology 2023Quote: ... falciparum 3D7 [129] were cultured in human red blood cells (O+; University Medical Center Hamburg, Eppendorf (UKE)) ...
-
bioRxiv - Cancer Biology 2021Quote: ... 3-6 pooled tissue biopsies were moved into a precooled 1.5 mL tube (Eppendorf, Germany) containing 300µL digestion cocktail consisting of Gibco RPMI 1640 (Thermo Fisher Scientific ...
-
bioRxiv - Microbiology 2021Quote: ... and centrifuged for 3 min at 13806 rpm (Centrifuge 5424, FA-45-24-11, Eppendorf) before use ...
-
bioRxiv - Microbiology 2019Quote: ... all culture samples were centrifuged for 3 min at 15871 rcf (Centrifuge 5424, Eppendorf, Germany) in 1.5-mL reaction tubes ...
-
bioRxiv - Bioengineering 2022Quote: ... the purification was carried out in 3 steps using a standard centrifuge (Eppendorf centrifuge 5425). We washed the sample using ethanol and 2 washing buffers provided by the kit ...
-
bioRxiv - Neuroscience 2022Quote: ... was added per well using electronic 12-channel pipettes in speed 3 (e12c-pip; Eppendorf). The plates were temporality incubated at 37°C ...
-
bioRxiv - Systems Biology 2022Quote: ... 3) collected filtrate was evaporated dry over-night in a concentrator (Eppendorf® concentrator plus) under vacuum conditions ...
-
bioRxiv - Systems Biology 2022Quote: ... After denaturation at 78 °C for 3 min on a flatblock thermocycler (Eppendorf, Mastercycler Nexus), samples were incubated at 45 °C for 36–48 hr in a benchtop incubator ...
-
bioRxiv - Genomics 2022Quote: ... Beads and proteins were incubated for 3 hours at 4°C (Eppendorf ThermoMixer, 1,300 rpm). Beads were then washed four times with lysis buffer and recovered in 40 µl of laemmli buffer (50 mM Tris-Cl pH 6.8 ...
-
bioRxiv - Molecular Biology 2022Quote: ... falciparum 3D7 (68) were cultured in human red blood cells (O+ or B+, Blood bank, Universitätsklinikum Hamburg-Eppendorf). Cultures were maintained at 37°C in an atmosphere of 1% O2 ...
-
bioRxiv - Neuroscience 2020Quote: ... Microinjection of 300 nl was made over 3 min using a Femtojet injector (~5 psi, Eppendorf), and the exposed cortical surface was covered by a sterilized round cover glass (3 or 4 mm in diameter ...
-
bioRxiv - Biochemistry 2022Quote: ... 3 ml was aliquoted to each of the duplicate 5.0 mL tubes (Eppendorf Tubes®, Germany) while 50 μL was aliquoted to each of the duplicate 200 μL Polymerase Chain Reaction (PCR ...
-
bioRxiv - Plant Biology 2022Quote: ... Fermentation was conducted in approximately 3 L of culture in a bioreactor BioFlo120 (Eppendorf, Hamburg, Germany) at 30°C for 5 days ...
-
bioRxiv - Genetics 2022Quote: ... and spun at 100x g for 3 min in a swing-bucket centrifuge (e.g., Eppendorf 5804R). The cycling conditions are 95°C for 3 min ...
-
bioRxiv - Microbiology 2023Quote: ... the fermentation broth was centrifuged at 9000 r/min for 3 min (Eppendorf Centrifuge 5424, Germany), and the resultant pellet was collected for bacterial DNA extraction using the FastDNA® Spin Kit for Soil (MP Biomedicals ...