Labshake search
Citations for Eppendorf :
1 - 50 of 738 citations for Pregnanediol 3 Glucuronide PDG ELISA Kit 5 Plate since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Evolutionary Biology 2024Quote: ... Plates were incubated for 5 hours at 37°C (Eppendorf Innova plate shaker) shaking at 750 rpm ...
-
bioRxiv - Biochemistry 2021Quote: ... Cells were maintained in a humidified atmosphere of 5% CO2 and 37 °C and were passaged every 2-3 days into 10 cm polystyrene coated plates (Eppendorf; EP0030700112-300EA) upon reaching high density ...
-
bioRxiv - Neuroscience 2021Quote: ... EGFP RVS 5’-3’= TGTGGCGGATCTTGAAGTTAG on a Mastercycler Pro (Eppendorf) thermocycler PCR machine ...
-
bioRxiv - Synthetic Biology 2022Quote: ... Plates were then centrifuged at 330 rpm for 3 min (Eppendorf, Centrifuge 5810). Plates were then incubated at 37°C for 24 hours ...
-
bioRxiv - Microbiology 2023Quote: ... qPCR analysis was carried out in 96 well plates using Quantstudio 3 (Eppendorf). Amplification was carried out at 95°C for 15 min and 50 cycles at 95°C for 15s ...
-
bioRxiv - Cell Biology 2022Quote: Samples were incubated on a rotator for 5 min at 4°C and then centrifuged at 500g for 5 min (Eppendorf, 5920R; 4°C, ramp speed of 3/3). Supernatant was removed and pellet was resuspended in sort buffer [1mM EDTA (Invitrogen ...
-
bioRxiv - Cancer Biology 2022Quote: ... topotecan-resistant Y79 (5×103) were plated into 96-well plates (Eppendorf, Sigma Aldrich) and incubated overnight ...
-
bioRxiv - Neuroscience 2020Quote: ... Microinjection of 300 nl was made over 3 min using a Femtojet injector (~5 psi, Eppendorf), and the exposed cortical surface was covered by a sterilized round cover glass (3 or 4 mm in diameter ...
-
bioRxiv - Systems Biology 2022Quote: ... The plate was then centrifuged at 1,000 rpm for 5 min using a centrifuge (Eppendorf, 5810R) that was precooled at the desired temperature (e.g ...
-
bioRxiv - Microbiology 2020Quote: ... The plates were then spun at 260g for 5 min at room temperature (Eppendorf 5810R centrifuge) and incubated at 33°C ...
-
bioRxiv - Bioengineering 2022Quote: ... Cell- and drug-containing plates were then centrifuged for 5 minutes at 135 x g (Eppendorf 5810R), then incubated for 72 hours at 37°C in 5% CO2 humidified atmosphere with gas permeable plate sealing film (VWR) ...
-
bioRxiv - Cancer Biology 2024Quote: ... Around 5 x 105 or fewer cells were used for staining (96 well plate or Eppendorf tubes). Cells were centrifuged at 1500 rpm for 5 minutes at 4°C ...
-
bioRxiv - Synthetic Biology 2023Quote: ... The sender strains deep-well plate was then centrifuged at 4000 rpm for 5 minutes (Centrifuge Eppendorf 5810R) and the supernatants were transferred by pipetting in a new 2 mL deep-well plate ...
-
bioRxiv - Plant Biology 2023Quote: ... Bound phosphopeptides were then eluted 3 times with 100 µL ammonium hydroxide (5% v/v) into 1.5mL Lo-Bind tubes (Eppendorf). These were then frozen and lyophilized ...
-
bioRxiv - Neuroscience 2023Quote: ... They were then resuspended to a concentration of ∼800-3000 nuclei per uL across 3-4 x twin.tec™ 96 Well LoBind PCR Plates (Eppendorf, 0030129512) in NSB ...
-
bioRxiv - Pharmacology and Toxicology 2019Quote: 1-5 intact Hydra polyps were incubated per well in a flat bottom 6-well plate (Eppendorf, Hamburg, Germany) filled with 8mL of HM or respective anesthesia ...
-
bioRxiv - Immunology 2019Quote: 1000 cells of CD4+ cells were sorted directly into 5 ul of TCL buffer (Qiagene, Cat#1031576) in skirted Eppendorf 96-well twin.tec PCR plate (Eppendorf). Smart-seq2 modified from a published method [13] was carried out at Broad Technology Labs ...
-
bioRxiv - Cell Biology 2021Quote: ... were vortexed 3 min at room temperature followed by centrifugation at 4,500 x g for 5 min at 4°C (Eppendorf #5010R). The supernatant fluid was poured into a chilled 2 ml screw-capped tube ...
-
bioRxiv - Genomics 2019Quote: ... Deep red-) Single cells were sorted into 5 ul of RLT 1%β-Mercaptoethanol in a 96 well plate (Eppendorf) and frozen at −80°C.
-
bioRxiv - Developmental Biology 2023Quote: ... the gRNA:Cas9 ribonucleoprotein complex solution was incubated at 37°C for 5 min and then backfilled into 3 microinjection needles using an Eppendorf GELoader tip (Eppendorf, Cat# 022351656). After loading embryos into the embryo holder which covered with 12.5 ppt of salinity water with 0.0001% of methylene blue ...
-
bioRxiv - Genomics 2023Quote: ... plates were incubated on a plate shaker (Eppendorf ThermoMixer Comfort) for 10 min (4° C ...
-
bioRxiv - Neuroscience 2021Quote: ... assay plates were incubated on a plate shaker (Eppendorf ThermoMixer Comfort) for 10 min (4°C ...
-
bioRxiv - Systems Biology 2020Quote: ... 5 Ml/well of the product from each 1st PCR plate was pooled into one specific well of the collection plate (Deepwell plate 96/500 μ!, Eppendorf; each well containing all 96 samples from one 1st PCR plate) ...
-
bioRxiv - Microbiology 2023Quote: ... gondii infected BMDCs were deposited into 384-well plates (Eppendorf twin.tecTM PCR plates) containing 2.3 μl of lysis buffer 114 using a CyClone™ robotic arm and at highly stringent single cell sort settings (single mode ...
-
bioRxiv - Microbiology 2023Quote: ... cultures were grown in 96-deepwell plates (Deepwell plate 96/2000 μL; Eppendorf), with each well containing 600 μL of culture ...
-
bioRxiv - Cell Biology 2021Quote: ... 3-liter Bioflo 110 (Eppendorf) were used ...
-
bioRxiv - Biochemistry 2021Quote: ... 10 µl of the samples or blanks were pipetted on the 96 well-plate based kit containing calibrators and internal standards using an automated liquid handling station (epMotion 5075, Eppendorf) and subsequently dried under a nitrogen stream using a positive pressure manifold (Waters) ...
-
bioRxiv - Cancer Biology 2023Quote: ... 10 µl of the samples or blanks were pipetted on the 96 well-plate-based kit containing calibrators and internal standards using an automated liquid handling station (epMotion 5075, Eppendorf) and subsequently dried under a nitrogen stream using a positive pressure manifold (Waters) ...
-
bioRxiv - Cell Biology 2022Quote: ... or 96 well plates (Eppendorf) three to one day before imaging ...
-
bioRxiv - Cancer Biology 2021Quote: ... or 12-well plates (Eppendorf) using standard protocols(Debnath et al ...
-
bioRxiv - Microbiology 2022Quote: ThermoMixers with plate adaptors (Eppendorf, model ThermoMixer C – cat ...
-
bioRxiv - Synthetic Biology 2022Quote: ... This plate was sealed (Eppendorf Masterclear real-time PCR film adhesive ...
-
bioRxiv - Synthetic Biology 2022Quote: ... This plate was sealed (Eppendorf Masterclear real-time PCR film adhesive ...
-
bioRxiv - Bioengineering 2023Quote: ... LoBind twin.tec PCR plates (Eppendorf) for a total volume of 60 µL at 1x master mix and 1x target concentration ...
-
bioRxiv - Microbiology 2024Quote: Sample were retrotranscribed in cDNA using 1 µL of RNA with 1 µL of Reverse Transcription Master Mix and 3 µL of RNase-free ultrapure water provided with the kit (Standard Biotools, USA) using a thermal cycler (Eppendorf, Germany) with the following cycles ...
-
bioRxiv - Cell Biology 2022Quote: ... Cells were plated on 24-well cell imaging plates (black plate with treated glass bottom, Eppendorf) and treated with siRNAs and 100nM nocodazole accordingly ...
-
bioRxiv - Systems Biology 2022Quote: ... we centrifuged each plate in a swinging bucket centrifuge with micro-well plate adaptors (Eppendorf 5810R) at a speed of 3,214 × g for 7 minutes ...
-
bioRxiv - Cell Biology 2023Quote: ... Cells were plated on 24-well cell imaging plates (black plate with treated glass bottom, Eppendorf) and treated with drugs and/or siRNAs accordingly ...
-
bioRxiv - Microbiology 2019Quote: ... on an AF2200 plate reader (Eppendorf), then fragmented and tagged via tagmentation ...
-
bioRxiv - Genomics 2022Quote: ... For 96-well plates (Eppendorf #0030129300), 25 μL of barcoded hydrogel templates were then distributed into each well with 4000 cells per well (2000 cells/μL x 2 μL) ...
-
bioRxiv - Cancer Biology 2022Quote: ... PolyPro plate (Eppendorf, Part number 30129300) and loaded on the AssayMAP Bravo platform for final clean up before injection into the mass spectrometer ...
-
bioRxiv - Microbiology 2023Quote: ... on Cell Imaging Plates (Eppendorf, Germany). Immediately before the infection or 1 ...
-
bioRxiv - Microbiology 2024Quote: ... 96-well glass bottom plates (Eppendorf) were plasma cleaned ...
-
bioRxiv - Cell Biology 2020Quote: ... and 5 % CO2 (Eppendorf). Jurkat CD4-KO cells were derived from wild-type Jurkat T cells (clone E6 ...
-
bioRxiv - Biophysics 2020Quote: 5) Centrifuge (Eppendorf, 5810R)
-
bioRxiv - Genomics 2020Quote: ... using a plate sealer (PX1 Plate Sealer #181-4000) for droplet PCR amplification (Eppendorf Mastercycler Pro #E90030010). The following cycling conditions were used ...
-
bioRxiv - Microbiology 2023Quote: ... The starting cell concentration was serially diluted in 96-deepwell plates (Deepwell plate 96/2000 μL; Eppendorf), covered with AeraSeal adhesive sealing films (Excel Scientific ...
-
bioRxiv - Microbiology 2023Quote: ... 600 μL of cultures were then grown in 96-deepwell plates (Deepwell plate 96/2000 μL; Eppendorf) and shaken at 1,050 r.p.m for 24 h at 30 °C ...
-
bioRxiv - Neuroscience 2020Quote: ... centrifuged (16000 g, 3 min, 5415R, Eppendorf) and re-suspended in fresh medium ...
-
bioRxiv - Neuroscience 2022Quote: ... in 96-well plates (Eppendorf, cat# 0030128680) and frozen at −80°C until library preparation.