Labshake search
Citations for Eppendorf :
1 - 50 of 490 citations for Potassium 3 4 difluorophenyl trifluoroborate since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cell Biology 2022Quote: Samples were incubated on a rotator for 5 min at 4°C and then centrifuged at 500g for 5 min (Eppendorf, 5920R; 4°C, ramp speed of 3/3). Supernatant was removed and pellet was resuspended in sort buffer [1mM EDTA (Invitrogen ...
-
bioRxiv - Cell Biology 2022Quote: ... Sorted nuclei were then centrifuged at 1000 g for 15 min (Eppendorf, 5920R; 4°C, ramp speed of 3/3), and supernatant was removed ...
-
bioRxiv - Genomics 2022Quote: ... Beads and proteins were incubated for 3 hours at 4°C (Eppendorf ThermoMixer, 1,300 rpm). Beads were then washed four times with lysis buffer and recovered in 40 µl of laemmli buffer (50 mM Tris-Cl pH 6.8 ...
-
bioRxiv - Biochemistry 2021Quote: ... cell cultures were collected by centrifugation at 3,300 rpm for 3 min at 4°C (using Eppendorf centrifuge 5810R equipped with the A-4-62 rotor ...
-
bioRxiv - Cell Biology 2023Quote: ... the expelled homogenate was palleted by centrifugation for 3 min (at 300 g at 4°C) (Eppendorf). The pellet was discarded ...
-
bioRxiv - Molecular Biology 2023Quote: ... Yeast were centrifuged at 3,000 rpm for 3 min in an A-4-62 swing bucket rotor (Eppendorf) and resuspended in 20 ml 1 M sorbitol and incubated at 4 °C overnight (<18 h) ...
-
bioRxiv - Evolutionary Biology 2024Quote: ... Samples were then extracted for 3 hr at 4°C in a ThermoMixer (Eppendorf US, Enfield, CT, USA), followed by evaporation of the methanol component with a speedvac concentrator (Thermo Fisher Scientific ...
-
bioRxiv - Cell Biology 2021Quote: ... were vortexed 3 min at room temperature followed by centrifugation at 4,500 x g for 5 min at 4°C (Eppendorf #5010R). The supernatant fluid was poured into a chilled 2 ml screw-capped tube ...
-
bioRxiv - Synthetic Biology 2022Quote: The concentration and quality of the plasmid solutions were determined by diluting 1 ul of plasmid solution in 4 ul of Tris EDTA buffer and loading 3 ul of the diluted solution on a μCuvette G1 (Eppendorf). Optical densities were measured at 260 nm and 280 nm using a BioSpectrophotometer and Fluorimeter (Eppendorf) ...
-
bioRxiv - Cancer Biology 2022Quote: ... Samples were vigorously vortex-mixed for 3 min and centrifuged at 14,000 rpm for 10 min at 4 °C (Eppendorf 5804 R). The clear supernatant was then transferred to a separate vial ...
-
bioRxiv - Plant Biology 2022Quote: ... annealing at 51 °C for 30 s and extension 72 °C for 30 s for 25 cycles by final extension 72 °C for 3 min and reaction hold at 4 °C in a thermocycler (Gradient thermocycler® Eppendorf). Amplified gene products were sequenced using the Sanger sequencing method ...
-
bioRxiv - Neuroscience 2024Quote: ... They were then resuspended to a concentration of ∼800-3000 nuclei per uL across 3-4 x twin.tec™ 96 Well LoBind PCR Plates (Eppendorf, 0030129512) in NSB ...
-
bioRxiv - Systems Biology 2021Quote: ... Total volume of 20 mL from each culture was transferred to a 50 mL Falcon® filled with ice and was immediately centrifuged at 3000 rpm for 3 min at 4 °C (Eppendorf centrifuge). Next the supernatant was discarded and the cell pellet was snap frozen into liquid nitrogen and stored at -80 °C ...
-
bioRxiv - Systems Biology 2021Quote: For the extraction of total proteome 10 mL of each culture were transferred into ice-cold 15 mL Falcon® tubes which were centrifuged immediately at 3000 rpm for 3 min at 4 °C (Eppendorf centrifuge). The supernatant from the centrifugation was discarded and the cell pellets were washed once with 1 mL of cold PBS buffer ...
-
bioRxiv - Plant Biology 2023Quote: ... The primers were annealed at 95°C for 4 min followed by 70°C for 3 min in a thermocycler (Eppendorf, Hamburg, Germany). The reaction was allowed to cool slowly to room temperature ...
-
bioRxiv - Cell Biology 2021Quote: ... 3-liter Bioflo 110 (Eppendorf) were used ...
-
bioRxiv - Molecular Biology 2022Quote: ... 4°C for 5 minutes (Eppendorf centrifuge 5810 R, Rotor S-4-104). Cell pellets were washed with 5 mL D-PBS and centrifugation was repeated ...
-
bioRxiv - Physiology 2022Quote: ... plasma was spun at 4°C (4 min, 4000g force, Eppendorf 5804R, Mississauga, ON), decanted and stored at −80°C for subsequent ELISAs ...
-
bioRxiv - Neuroscience 2020Quote: ... centrifuged (16000 g, 3 min, 5415R, Eppendorf) and re-suspended in fresh medium ...
-
bioRxiv - Genomics 2024Quote: ... 4 °C with acceleration and deceleration set to 1 (Eppendorf 5910 Ri, Rotor S-4×400).
-
bioRxiv - Neuroscience 2020Quote: ... and rotor (Eppendorf #S-4-72). Upon end of centrifugation ...
-
bioRxiv - Plant Biology 2021Quote: ... 4 C (Eppendorf Centrifuge 5418 R). Proteins in the clear supernatant (protein extract ...
-
bioRxiv - Plant Biology 2021Quote: ... 4 C (Eppendorf Centrifuge 5418 R). 15 µg of recombinant FAMOSS-streptavidin/streptavidin was added to supernatant and incubated 1h on ice with rotation ...
-
bioRxiv - Synthetic Biology 2024Quote: ... in a MasterCycler RealPlex 4 (Eppendorf). Each 20 μL qPCR reaction contained 90 ng of cDNA ...
-
bioRxiv - Biophysics 2023Quote: ... with a micromanipulator InjectMan 4 (Eppendorf). The injection needles Femtotip II (Eppendorf ...
-
bioRxiv - Bioengineering 2024Quote: ... 4 °C (Eppendorf, Centrifuge 5810 R). Next ...
-
bioRxiv - Plant Biology 2024Quote: ... Plants (3 plants in 2 mL Eppendorf tubes) were harvested at Zeitgeber time (ZT ...
-
bioRxiv - Biochemistry 2020Quote: ... The lysate was centrifuged at 4°C (3220 g for 5 min, Eppendorf #A-4-81 rotor) to remove intact cells and debris ...
-
bioRxiv - Genomics 2023Quote: ... and centrifuged at 3,200 g and 4°C using a swinging-bucket rotor (Eppendorf A-4-81) for 5 mins ...
-
bioRxiv - Systems Biology 2024Quote: 20 mL of culture from each of 3 experimental replicates (n = 3) was collected in Protein LoBind tubes (Eppendorf, Hamburg, Germany) by centrifugation at 1650 xg for 10 min ...
-
bioRxiv - Immunology 2020Quote: ... (Eppendorf Centrifuge 5810R, rotor A-4-62) at room temperature ...
-
bioRxiv - Cell Biology 2021Quote: ... in a Realplex 4 PCR machine (Eppendorf), and values were normalized to rpl-32 as an internal control ...
-
bioRxiv - Biophysics 2022Quote: ... and a micro-manipulator (Injectman 4; Eppendorf). Injection pipettes were prepared from siliconized (Sigmacote ...
-
bioRxiv - Cell Biology 2023Quote: ... in a realplex 4 qPCR cycler (Eppendorf). To calculate the relative mtDNA levels ...
-
bioRxiv - Molecular Biology 2024Quote: Centrifuge rotor A-4-62 (Eppendorf, 022638009)
-
bioRxiv - Cell Biology 2024Quote: ... and a micro-manipulator (Injectman 4, Eppendorf). Injection needles were prepared from siliconized (Sigmacote ...
-
bioRxiv - Evolutionary Biology 2024Quote: ... Injection was performed with InjectMan 4 (Eppendorf) and Eppendorf femtotips using an Olympus IX71 microscope ...
-
bioRxiv - Cell Biology 2024Quote: ... with A-4-81 Rotor (Eppendorf, Germany) to remove the dead cells and cell debris ...
-
bioRxiv - Biochemistry 2022Quote: ... The lysate was centrifuged at 4°C (3220 g for 5 min, A-4-81 rotor, Eppendorf, Enfield, CT) to remove intact cells and debris ...
-
bioRxiv - Biochemistry 2020Quote: ... The resin was pelleted down by centrifugation at 4°C (1258 g for 5 min, Eppendorf #A-4-81 rotor) and washed with ice-cold 50 mL Binding buffer composed of 10 mM imidazole (pH 7.4) ...
-
bioRxiv - Microbiology 2021Quote: ... The samples were immediately cooled on ice and centrifuged for 12 min at 4°C and 3700 rpm (Centrifuge 5920 R, S-4×1000, Eppendorf). The cell pellets were stored at −20°C until RNA extraction.
-
bioRxiv - Microbiology 2021Quote: ... The cells were transferred into anaerobic 50 mL reaction tubes inside the anaerobic chamber and harvested outside of the anaerobic chamber for 12 min at 4°C and 3700 rpm (Centrifuge 5920 R, S-4×1000, Eppendorf). The supernatant was discarded inside the anaerobic chamber and the pellet was resuspended in fresh RCM medium to an OD600 of 5-10 ...
-
bioRxiv - Neuroscience 2024Quote: Suspensions were centrifuged at 4°C in 50 mL centrifuge tubes (Falcon) with a 5810R centrifuge and an A-4-81 rotor (Eppendorf) and in 38.5 mL polyallomer Ultra Clear ultracentrifuge tubes (Beckman Coulter ...
-
bioRxiv - Cell Biology 2022Quote: ... and InjectMan®4 micromanipulator (Cat#. 5192000035, Eppendorf) using external continuous pressure ...
-
bioRxiv - Immunology 2021Quote: ... at 10.000 rpm and 4°C (Eppendorf 5804R), for the removal of residual titanium [16].
-
bioRxiv - Cell Biology 2022Quote: ... for 10 minutes at 4°C (Eppendorf, Germany), and supernatants were transferred into fresh tubes to be evaporated to dryness in a CentreVap concentrator at 40°C (Labconco ...
-
bioRxiv - Bioengineering 2024Quote: ... 15 min at 4°C (Eppendorf, Hamburg, Germany). duRNA was generated through equimolar annealing of trRNA/crRNA in duplex buffer (IDT) ...
-
bioRxiv - Microbiology 2024Quote: ... or MasterCycler EP Realplex 4 thermal cycler (Eppendorf). Data were analyzed using recA and gyrA as internal controls ...
-
bioRxiv - Neuroscience 2021Quote: ... EGFP RVS 5’-3’= TGTGGCGGATCTTGAAGTTAG on a Mastercycler Pro (Eppendorf) thermocycler PCR machine ...
-
bioRxiv - Neuroscience 2024Quote: ... regionalized neural organoids (1-3 organoids per one Eppendorf tube) were transferred into a 1.5 mL Eppendorf tube containing 200 μL of the neural medium ...